rs1553683757

Variant names:

• chr2-227102759-TCACTGATGTTAACAGCAAATGATGCTTACCCGAGGCCCTGGAAATC-T
• rs1553683757
• NM_000092.5:c.914_930+29delGATTTCCAGGGCCTCGGGTAAGCATCATTTGCTGTTAACATCAGTG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000092.5(COL4A4):​c.914_930+29delGATTTCCAGGGCCTCGGGTAAGCATCATTTGCTGTTAACATCAGTG​(p.Phe306fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000315 in 1,585,214 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: 𝑓 0.000020 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0000014 (0 hom.)
• Consequence: COL4A4 NM_000092.5 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:7
• Conservation: PhyloP100: 1.35
• Publications: 0 publications found

Genes affected

COL4A4 (HGNC:2206): (collagen type IV alpha 4 chain) This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. This particular collagen IV subunit, however, is only found in a subset of basement membranes. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. Mutations in this gene are associated with type II autosomal recessive Alport syndrome (hereditary glomerulonephropathy) and with familial benign hematuria (thin basement membrane disease). Two transcripts, differing only in their transcription start sites, have been identified for this gene and, as is common for collagen genes, multiple polyadenylation sites are found in the 3' UTR. [provided by RefSeq, Jul 2008]

COL4A4 Gene-Disease associations (from GenCC):

• autosomal recessive Alport syndrome

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, G2P, Myriad Women’s Health, Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
• Alport syndrome

  Inheritance: SD Classification: DEFINITIVE Submitted by: ClinGen
• hematuria, benign familial, 1

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Genomics England PanelApp
• autosomal dominant Alport syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 2-227102759-TCACTGATGTTAACAGCAAATGATGCTTACCCGAGGCCCTGGAAATC-T is Pathogenic according to our data. Variant chr2-227102759-TCACTGATGTTAACAGCAAATGATGCTTACCCGAGGCCCTGGAAATC-T is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 447196.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000092.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	COL4A4	NM_000092.5	MANE Select	c.914_930+29delGATTTCCAGGGCCTCGGGTAAGCATCATTTGCTGTTAACATCAGTG	p.Phe306fs	frameshift splice_donor splice_region intron	Exon 15 of 48	NP_000083.3	P53420

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	COL4A4	ENST00000396625.5	TSL:5 MANE Select	c.914_930+29delGATTTCCAGGGCCTCGGGTAAGCATCATTTGCTGTTAACATCAGTG	p.Phe306fs	frameshift splice_donor splice_region intron	Exon 15 of 48	ENSP00000379866.3	P53420
	COL4A4	ENST00000643379.1		c.*26_*71delGATTTCCAGGGCCTCGGGTAAGCATCATTTGCTGTTAACATCAGTG		downstream_gene	N/A	ENSP00000494516.1	A0A2R8Y548

Frequencies

GnomAD3 genomes AF: 0.0000197 AC: 3 AN: 152174 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000196

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.00000140 AC: 2 AN: 1433040 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 715150

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 32852

American (AMR) AF: 0.0000224 AC: 1 AN: 44692

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25980

East Asian (EAS) AF: 0.00 AC: 0 AN: 39550

South Asian (SAS) AF: 0.00 AC: 0 AN: 85672

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53408

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5736

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1085706

Other (OTH) AF: 0.0000168 AC: 1 AN: 59444

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.00000037155), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000197 AC: 3 AN: 152174 Hom.: 0 Cov.: 32 AF XY: 0.0000269 AC XY: 2 AN XY: 74350

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 41440

American (AMR) AF: 0.000196 AC: 3 AN: 15270

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5202

South Asian (SAS) AF: 0.00 AC: 0 AN: 4828

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10610

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 68032

Other (OTH) AF: 0.00 AC: 0 AN: 2094

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0.00000000298604), which strongly suggests a high chance of mosaicism in these individuals.

Alfa AF: 0.00 Hom.: 0

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
5	-	-	not provided (5)
1	-	-	Alport syndrome (1)
1	-	-	Autosomal recessive Alport syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.4
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553683757; hg19: chr2-227967475;