rs1553683757
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000092.5(COL4A4):c.914_930+29delGATTTCCAGGGCCTCGGGTAAGCATCATTTGCTGTTAACATCAGTG(p.Phe306fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000315 in 1,585,214 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000092.5 frameshift, splice_donor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- autosomal recessive Alport syndromeInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Myriad Women's Health, Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P, Orphanet
- Alport syndromeInheritance: SD Classification: DEFINITIVE Submitted by: ClinGen
- hematuria, benign familial, 1Inheritance: AD Classification: STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
- autosomal dominant Alport syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000092.5. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| COL4A4 | TSL:5 MANE Select | c.914_930+29delGATTTCCAGGGCCTCGGGTAAGCATCATTTGCTGTTAACATCAGTG | p.Phe306fs | frameshift splice_donor splice_region intron | Exon 15 of 48 | ENSP00000379866.3 | P53420 | ||
| COL4A4 | c.*26_*71delGATTTCCAGGGCCTCGGGTAAGCATCATTTGCTGTTAACATCAGTG | downstream_gene | N/A | ENSP00000494516.1 | A0A2R8Y548 |
Frequencies
GnomAD3 genomes AF: 0.0000197 AC: 3AN: 152174Hom.: 0 Cov.: 32 show subpopulations
GnomAD4 exome AF: 0.00000140 AC: 2AN: 1433040Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 715150 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
GnomAD4 genome AF: 0.0000197 AC: 3AN: 152174Hom.: 0 Cov.: 32 AF XY: 0.0000269 AC XY: 2AN XY: 74350 show subpopulations ⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.