NM_000141.5:c.859_921delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC

Variant names:

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PM1PM4PP3PP5

The NM_000141.5(FGFR2):c.859_921delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC(p.His287_Pro307del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

Frequency

Genomes: not found (cov: 33)

Consequence

FGFR2
NM_000141.5 conservative_inframe_deletion

Scores

Not classified

Clinical Significance

Pathogenic no assertion criteria provided P:1

Conservation

PhyloP100: 9.99

Publications

0 publications found

Variant links:

Genes affected

FGFR2 (HGNC:3689): (fibroblast growth factor receptor 2) The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member is a high-affinity receptor for acidic, basic and/or keratinocyte growth factor, depending on the isoform. Mutations in this gene are associated with Crouzon syndrome, Pfeiffer syndrome, Craniosynostosis, Apert syndrome, Jackson-Weiss syndrome, Beare-Stevenson cutis gyrata syndrome, Saethre-Chotzen syndrome, and syndromic craniosynostosis. Multiple alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jan 2009]

FGFR2 Gene-Disease associations (from GenCC):

Apert syndrome
Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, ClinGen, PanelApp Australia, G2P, Genomics England PanelApp
Beare-Stevenson cutis gyrata syndrome
Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, ClinGen, G2P, Genomics England PanelApp
Crouzon syndrome
Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, ClinGen, PanelApp Australia, Genomics England PanelApp, G2P
Jackson-Weiss syndrome
Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp, G2P
LADD syndrome 1
Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
Pfeiffer syndrome
Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: ClinGen, PanelApp Australia, Labcorp Genetics (formerly Invitae), Ambry Genetics, Genomics England PanelApp, G2P
Antley-Bixler syndrome without genital anomalies or disordered steroidogenesis
Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp, G2P
bent bone dysplasia syndrome 1
Inheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Orphanet
familial scaphocephaly syndrome, McGillivray type
Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
Saethre-Chotzen syndrome
Inheritance: AD Classification: STRONG Submitted by: PanelApp Australia, Genomics England PanelApp
Antley-Bixler syndrome
Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
LADD syndrome
Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Pfeiffer syndrome type 1
Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Pfeiffer syndrome type 2
Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Pfeiffer syndrome type 3
Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

FGFR2 links:

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

PM1

In a hotspot region, there are 11 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 1 uncertain in NM_000141.5

PM4

Nonframeshift variant in NON repetitive region in NM_000141.5.

PP3

No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

PP5

Variant 10-121519996-AGGGCAGCCCGTCGGGCCCGTATTTACTGCCGTTCTTTTCCACGTGCTTGATCCACTGGATGTG-A is Pathogenic according to our data. Variant chr10-121519996-AGGGCAGCCCGTCGGGCCCGTATTTACTGCCGTTCTTTTCCACGTGCTTGATCCACTGGATGTG-A is described in ClinVar as Pathogenic. ClinVar VariationId is 29852.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
FGFR2	NM_000141.5 link	c.859_921delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC	p.His287_Pro307del	conservative_inframe_deletion	Exon 7 of 18	ENST00000358487.10	NP_000132.3	P21802-1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	UniProt
FGFR2	ENST00000358487.10 link	c.859_921delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC	p.His287_Pro307del	conservative_inframe_deletion	Exon 7 of 18	1	NM_000141.5	ENSP00000351276.6	P21802-1
FGFR2	ENST00000457416.7 link	c.859_921delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC	p.His287_Pro307del	conservative_inframe_deletion	Exon 7 of 18	1		ENSP00000410294.2	P21802-3
FGFR2	ENST00000369056.5 link	c.859_921delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC	p.His287_Pro307del	conservative_inframe_deletion	Exon 6 of 17	1		ENSP00000358052.1	P21802-17
FGFR2	ENST00000369058.7 link	c.859_921delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC	p.His287_Pro307del	conservative_inframe_deletion	Exon 7 of 17	1		ENSP00000358054.3	A0A5S6RJB7
FGFR2	ENST00000613048.4 link	c.592_654delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC	p.His198_Pro218del	conservative_inframe_deletion	Exon 6 of 17	5		ENSP00000484154.1	D2CGD1
FGFR2	ENST00000369059.5 link	c.514_576delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC	p.His172_Pro192del	conservative_inframe_deletion	Exon 5 of 16	5		ENSP00000358055.1	E7EVR7
FGFR2	ENST00000360144.7 link	c.592_654delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC	p.His198_Pro218del	conservative_inframe_deletion	Exon 6 of 17	2		ENSP00000353262.3	P21802-22
FGFR2	ENST00000478859.5 link	c.175_237delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC	p.His59_Pro79del	conservative_inframe_deletion	Exon 6 of 17	1		ENSP00000474011.1	S4R381
FGFR2	ENST00000604236.5 link	n.514_576delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC		non_coding_transcript_exon_variant	Exon 5 of 17	1		ENSP00000474109.1	S4R3B2
FGFR2	ENST00000369061.8 link	c.749-4740_749-4678delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC		intron_variant	Intron 5 of 14	1		ENSP00000358057.4	P21802-23

Frequencies

GnomAD3 genomes

Cov.:

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome

Cov.:

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

LINK: link

Submissions by phenotype

Beare-Stevenson cutis gyrata syndrome

Pathogenic:1

Aug 01, 2009

OMIM

Significance:Pathogenic

Review Status:no assertion criteria provided

Collection Method:literature only

- -

Computational scores

Source: dbNSFP v4.3

Name

Calibrated prediction

Score

Prediction

PhyloP100

Mutation Taster

=0/200

disease causing (ClinVar)

(source)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

You must be logged in to view publications. This limit was set because tens of millions (!) of queries from AI bots are generated daily.

Variant summary

Frequency

Consequence

Scores

Clinical Significance

Conservation

Publications

ACMG classification

Transcripts

RefSeq

Ensembl

Frequencies

ClinVar

Submissions by phenotype

Computational scores

Splicing

Publications

Other links and lift over