NM_000141.5:c.859_921delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC
Variant summary
Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PM1PM2PM4PP3PP5
The NM_000141.5(FGFR2):c.859_921delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC(p.His287_Pro307del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).
Frequency
Genomes: not found (cov: 33)
Consequence
FGFR2
NM_000141.5 conservative_inframe_deletion
NM_000141.5 conservative_inframe_deletion
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 9.99
Genes affected
FGFR2 (HGNC:3689): (fibroblast growth factor receptor 2) The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member is a high-affinity receptor for acidic, basic and/or keratinocyte growth factor, depending on the isoform. Mutations in this gene are associated with Crouzon syndrome, Pfeiffer syndrome, Craniosynostosis, Apert syndrome, Jackson-Weiss syndrome, Beare-Stevenson cutis gyrata syndrome, Saethre-Chotzen syndrome, and syndromic craniosynostosis. Multiple alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jan 2009]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Likely_pathogenic. Variant got 8 ACMG points.
PM1
In a strand (size 6) in uniprot entity FGFR2_HUMAN there are 10 pathogenic changes around while only 0 benign (100%) in NM_000141.5
PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_000141.5.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
PP5
Variant 10-121519996-AGGGCAGCCCGTCGGGCCCGTATTTACTGCCGTTCTTTTCCACGTGCTTGATCCACTGGATGTG-A is Pathogenic according to our data. Variant chr10-121519996-AGGGCAGCCCGTCGGGCCCGTATTTACTGCCGTTCTTTTCCACGTGCTTGATCCACTGGATGTG-A is described in ClinVar as [Pathogenic]. Clinvar id is 29852.Status of the report is no_assertion_criteria_provided, 0 stars.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
FGFR2 | ENST00000358487.10 | c.859_921delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC | p.His287_Pro307del | conservative_inframe_deletion | Exon 7 of 18 | 1 | NM_000141.5 | ENSP00000351276.6 | ||
FGFR2 | ENST00000457416.7 | c.859_921delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC | p.His287_Pro307del | conservative_inframe_deletion | Exon 7 of 18 | 1 | ENSP00000410294.2 | |||
FGFR2 | ENST00000369056.5 | c.859_921delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC | p.His287_Pro307del | conservative_inframe_deletion | Exon 6 of 17 | 1 | ENSP00000358052.1 | |||
FGFR2 | ENST00000369058.7 | c.859_921delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC | p.His287_Pro307del | conservative_inframe_deletion | Exon 7 of 17 | 1 | ENSP00000358054.3 | |||
FGFR2 | ENST00000613048.4 | c.592_654delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC | p.His198_Pro218del | conservative_inframe_deletion | Exon 6 of 17 | 5 | ENSP00000484154.1 | |||
FGFR2 | ENST00000369059.5 | c.514_576delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC | p.His172_Pro192del | conservative_inframe_deletion | Exon 5 of 16 | 5 | ENSP00000358055.1 | |||
FGFR2 | ENST00000360144.7 | c.592_654delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC | p.His198_Pro218del | conservative_inframe_deletion | Exon 6 of 17 | 2 | ENSP00000353262.3 | |||
FGFR2 | ENST00000478859.5 | c.175_237delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC | p.His59_Pro79del | conservative_inframe_deletion | Exon 6 of 17 | 1 | ENSP00000474011.1 | |||
FGFR2 | ENST00000369061.8 | c.749-4740_749-4678delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC | intron_variant | Intron 5 of 14 | 1 | ENSP00000358057.4 | ||||
FGFR2 | ENST00000604236.5 | n.514_576delCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCGACGGGCTGCCC | non_coding_transcript_exon_variant | Exon 5 of 17 | 1 | ENSP00000474109.1 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 33
GnomAD4 genome
Cov.:
33
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: no assertion criteria provided
LINK: link
Submissions by phenotype
Beare-Stevenson cutis gyrata syndrome Pathogenic:1
Aug 01, 2009
OMIM
Significance: Pathogenic
Review Status: no assertion criteria provided
Collection Method: literature only
- -
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at