NM_000143.4:c.786_806delAAAAGCTGCCATGCCAAGAAT

Variant names:

• chr1-241506100-GATTCTTGGCATGGCAGCTTTT-G
• rs786202220
• NM_000143.4:c.786_806delAAAAGCTGCCATGCCAAGAAT

Variant summary

Our verdict is Pathogenic. The variant received 17 ACMG points: 17P and 0B. PS3 PM1 PM4 PP3 PP5_Very_Strong

The NM_000143.4(FH):​c.786_806delAAAAGCTGCCATGCCAAGAAT​(p.Lys263_Ile269del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). ClinVar reports functional evidence for this variant: "SCV000215625: This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). This amino acid region is well conserved in available vertebrate species. In addition, this alteration is predicted to be deleterious by in silico analysis (Choi Y et al. PLoS ONE. 2012" and additional evidence is available in ClinVar.

• Frequency: Genomes: not found (cov: 32)
• Consequence: FH NM_000143.4 disruptive_inframe_deletion
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:5 U:1
• Conservation: PhyloP100: 9.35
• Publications: 1 publications found

Genes affected

FH (HGNC:3700): (fumarate hydratase) The protein encoded by this gene is an enzymatic component of the tricarboxylic acid (TCA) cycle, or Krebs cycle, and catalyzes the formation of L-malate from fumarate. It exists in both a cytosolic form and an N-terminal extended form, differing only in the translation start site used. The N-terminal extended form is targeted to the mitochondrion, where the removal of the extension generates the same form as in the cytoplasm. It is similar to some thermostable class II fumarases and functions as a homotetramer. Mutations in this gene can cause fumarase deficiency and lead to progressive encephalopathy. [provided by RefSeq, Jul 2008]

FH Gene-Disease associations (from GenCC):

• hereditary leiomyomatosis and renal cell cancer

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet, G2P, ClinGen, Ambry Genetics
• fumaric aciduria

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae)
• pheochromocytoma-paraganglioma

  Inheritance: AD Classification: STRONG Submitted by: Ambry Genetics
• leiomyosarcoma

  Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
• hereditary pheochromocytoma-paraganglioma

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 17 ACMG points.

• PS3: PS3 evidence extracted from ClinVar submissions: SCV000215625: This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). This amino acid region is well conserved in available vertebrate species. In addition, this alteration is predicted to be deleterious by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). no
• PM1: In a hotspot region, there are 2 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 3 benign, 33 uncertain in NM_000143.4
• PM4: Nonframeshift variant in NON repetitive region in NM_000143.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 1-241506100-GATTCTTGGCATGGCAGCTTTT-G is Pathogenic according to our data. Variant chr1-241506100-GATTCTTGGCATGGCAGCTTTT-G is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 185496.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000143.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FH	NM_000143.4	MANE Select	c.786_806delAAAAGCTGCCATGCCAAGAAT	p.Lys263_Ile269del	disruptive_inframe_deletion	Exon 6 of 10	NP_000134.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FH	ENST00000366560.4	TSL:1 MANE Select	c.786_806delAAAAGCTGCCATGCCAAGAAT	p.Lys263_Ile269del	disruptive_inframe_deletion	Exon 6 of 10	ENSP00000355518.4	P07954-1
	FH	ENST00000958409.1		c.783_803delAAAAGCTGCCATGCCAAGAAT	p.Lys262_Ile268del	disruptive_inframe_deletion	Exon 6 of 10	ENSP00000628468.1
	FH	ENST00000932939.1		c.738_758delAAAAGCTGCCATGCCAAGAAT	p.Lys247_Ile253del	disruptive_inframe_deletion	Exon 6 of 10	ENSP00000602998.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

Alfa AF: 0.00 Hom.: 0

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
3	-	-	not provided (3)
-	1	-	Fumarase deficiency (1)
1	-	-	Hereditary cancer-predisposing syndrome (1)
1	-	-	Hereditary leiomyomatosis and renal cell cancer (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.3
Mutation Taster		=4/196	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs786202220; hg19: chr1-241669400;