rs786202220

Variant names:

• chr1-241506100-GATTCTTGGCATGGCAGCTTTT-G
• rs786202220
• NM_000143.4:c.786_806delAAAAGCTGCCATGCCAAGAAT

Variant summary

Our verdict is Pathogenic. Variant got 15 ACMG points: 15P and 0B. PM1 PM2 PM4 PP3 PP5_Very_Strong

The NM_000143.4(FH):​c.786_806delAAAAGCTGCCATGCCAAGAAT​(p.Lys263_Ile269del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: FH NM_000143.4 disruptive_inframe_deletion
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:5 U:1
• Conservation: PhyloP100: 9.35

Genes affected

FH (HGNC:3700): (fumarate hydratase) The protein encoded by this gene is an enzymatic component of the tricarboxylic acid (TCA) cycle, or Krebs cycle, and catalyzes the formation of L-malate from fumarate. It exists in both a cytosolic form and an N-terminal extended form, differing only in the translation start site used. The N-terminal extended form is targeted to the mitochondrion, where the removal of the extension generates the same form as in the cytoplasm. It is similar to some thermostable class II fumarases and functions as a homotetramer. Mutations in this gene can cause fumarase deficiency and lead to progressive encephalopathy. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 15 ACMG points.

• PM1: In a hotspot region, there are 2 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 3 benign, 15 uncertain in NM_000143.4
• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000143.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 1-241506100-GATTCTTGGCATGGCAGCTTTT-G is Pathogenic according to our data. Variant chr1-241506100-GATTCTTGGCATGGCAGCTTTT-G is described in ClinVar as [Likely_pathogenic]. Clinvar id is 185496.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
FH	NM_000143.4	c.786_806delAAAAGCTGCCATGCCAAGAAT	p.Lys263_Ile269del	disruptive_inframe_deletion	Exon 6 of 10	ENST00000366560.4	NP_000134.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
FH	ENST00000366560.4	c.786_806delAAAAGCTGCCATGCCAAGAAT	p.Lys263_Ile269del	disruptive_inframe_deletion	Exon 6 of 10	1	NM_000143.4	ENSP00000355518.4

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:5 Uncertain:1

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Pathogenic:3

Aug 04, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.786_806del, results in the deletion of 7 amino acid(s) of the FH protein (p.Lys263_Ile269del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individuals with hereditary leiomyomatosis and renal cell cancer (HLRCC) (Invitae). ClinVar contains an entry for this variant (Variation ID: 185496). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. For these reasons, this variant has been classified as Pathogenic. -

Mar 10, 2020

GeneDx

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Not observed in large population cohorts (Lek et al., 2016); In-frame deletion of 7 amino acids in a non-repeat region; In silico analysis supports a deleterious effect on protein structure/function; Has not been previously published as pathogenic or benign to our knowledge -

Jun 12, 2023

Quest Diagnostics Nichols Institute San Juan Capistrano

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The FH c.786_806del (p.Lys263_Ile269del) variant has been reported in individuals with hereditary leiomyomatosis and renal cell cancer (HLRCC). There are no published functional effects of this variant. However, structural analysis revealed that this variant may be present in a region critical to protein function and results in a disruption of nearby residues (PMID: 21445611 (2011)). This variant has not been reported in large, multi-ethnic general populations (Genome Aggregation Database, http://gnomad.broadinstitute.org). Based on the available information, this variant is classified as pathogenic. -

Hereditary leiomyomatosis and renal cell cancer Pathogenic:1

Jul 12, 2023

Myriad Genetics, Inc.

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is considered likely pathogenic. This variant has been reported in multiple individuals with clinical features of gene-specific disease. This variant is expected to disrupt protein structure [Myriad internal data]. -

Hereditary cancer-predisposing syndrome Pathogenic:1

Feb 25, 2025

Ambry Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.786_806del21 pathogenic mutation (also known as p.I262_R268del) is located in coding exon 6 of the FH gene. This variant results from an in-frame deletion of 21 nucleotides from positions 786 to 806. This results in the deletion of 7 amino acid residues from codons 262 to 268. The exact functional impact of these amino acids is unknown at this time; however, internal structural analysis suggests the I262_R268del alteration results in a distortion of the alpha-helix of the protein-protein interface, significantly altering the surrounding residues (Kavanagh KL et al. Crystal structure of human fumarate hydratase. Structural Genomics Consortium. Protein Data Bank, accessed 10/13/2015. DOI:10.2210/pdb3e04/pdb). This variant was reported in individual(s) with features consistent with FH-associated disease (Ambry internal data). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). This amino acid region is well conserved in available vertebrate species. In addition, this alteration is predicted to be deleterious by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Based on the supporting evidence, this alteration is interpreted as a disease-causing mutation. -

Fumarase deficiency Uncertain:1

Jun 01, 2023

Baylor Genetics

Significance: Uncertain significance

Review Status: flagged submission

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs786202220; hg19: chr1-241669400;