NM_000152.5:c.-32-385_143del
- chr17-80104166-AAGTGGGAGGATTGCTTGAGTCTGGGAGGTGGAGGTTGCAGTGAGCCAGGATCTCACCACAGCACTCTGGCCCAGGCGACAGCTGTTTGGCCTGTTTCAAGTGTCTACCTGCCTTGCTGGTCTTCCTGGGGACATTCTAAGCGTGTTTGATTTGTAACATTTTAGCAGACTGTGCAAGTGCTCTGCACTCCCCTGCTGGAGCTTTTCTCGCCCTTCCTTCTGGCCCTCTCCCCAGTCTAGACAGCAGGGCAACACCCACCCTGGCCACCTTACCCCACCTGCCTGGGTGCTGCAGTGCCAGCCGCGGTTGATGTCTCAGAGCTGCTTTGAGAGCCCCGTGAGTGCCGCCCCTCCCGCCTCCCTGCTGAGCCCGCTTTCTTCTCCCGCAGGCCTGTAGGAGCTGTCCAGGCCATCTCCAACCATGGGAGTGAGGCACCCGCCCTGCTCCCACCGGCTCCTGGCCGTCTGCGCCCTCGTGTCCTTGGCAACCGCTGCACTCCTGGGGCACATCCTACTCCATGATTTCCTGCTGGTTCCCCGAGAGCTGAGTGGCTCCTCCCC-A
- NM_000152.5:c.-32-385_143del
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_000152.5(GAA):c.-32-385_143del variant causes a splice acceptor, 5 prime UTR truncation, exon loss, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).
Frequency
Consequence
NM_000152.5 splice_acceptor, 5_prime_UTR_truncation, exon_loss, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- glycogen storage disease IIInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), PanelApp Australia, ClinGen, G2P
- glycogen storage disease due to acid maltase deficiency, infantile onsetInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- glycogen storage disease due to acid maltase deficiency, late-onsetInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
GAA | NM_000152.5 | c.-32-385_143del | p.Met1fs | frameshift_variant, start_lost, splice_region_variant | Exon 2 of 20 | ENST00000302262.8 | NP_000143.2 | |
GAA | NM_000152.5 | c.-32-385_143del | splice_acceptor_variant, 5_prime_UTR_truncation, exon_loss_variant, splice_region_variant, intron_variant | Exon 2 of 20 | ENST00000302262.8 | NP_000143.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
GAA | ENST00000302262.8 | c.-32-388_140del | p.Met1fs | frameshift_variant, start_lost, splice_region_variant | Exon 2 of 20 | 1 | NM_000152.5 | ENSP00000305692.3 | ||
GAA | ENST00000302262.8 | c.-32-388_140del | splice_acceptor_variant, 5_prime_UTR_truncation, exon_loss_variant, splice_region_variant, intron_variant | Exon 2 of 20 | 1 | NM_000152.5 | ENSP00000305692.3 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Glycogen storage disease, type II Pathogenic:1
For these reasons, this variant has been classified as Pathogenic. This variant disrupts a region of the GAA protein in which other variant(s) (p.Met1?) have been determined to be pathogenic (PMID: 18425781, 22252923, 29124014, 29422078, 31086307). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. This variant has not been reported in the literature in individuals affected with GAA-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change affects the initiator methionine of the GAA mRNA. The next in-frame methionine is located at codon 122. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at