NM_000190.4:c.9_33+11delTAACGGCAATGCGGCTGCAACGGCGGTGAGTGCTGA

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_000190.4(HMBS):​c.9_33+11delTAACGGCAATGCGGCTGCAACGGCGGTGAGTGCTGA​(p.Asn4ProfsTer347) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

Frequency

Genomes: not found (cov: 31)

Consequence

HMBS
NM_000190.4 frameshift, splice_donor, splice_region, intron

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 1.51
Variant links:
Genes affected
HMBS (HGNC:4982): (hydroxymethylbilane synthase) This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 75 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 11-119085041-GTAACGGCAATGCGGCTGCAACGGCGGTGAGTGCTGA-G is Pathogenic according to our data. Variant chr11-119085041-GTAACGGCAATGCGGCTGCAACGGCGGTGAGTGCTGA-G is described in ClinVar as [Pathogenic]. Clinvar id is 3254787.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
HMBSNM_000190.4 linkc.9_33+11delTAACGGCAATGCGGCTGCAACGGCGGTGAGTGCTGA p.Asn4ProfsTer347 frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant Exon 1 of 14 ENST00000652429.1 NP_000181.2 P08397-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
HMBSENST00000652429.1 linkc.9_33+11delTAACGGCAATGCGGCTGCAACGGCGGTGAGTGCTGA p.Asn4ProfsTer347 frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant Exon 1 of 14 NM_000190.4 ENSP00000498786.1 P08397-1

Frequencies

GnomAD3 genomes
Cov.:
31
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
31

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Acute intermittent porphyria Pathogenic:1
Jul 17, 2023
Victorian Clinical Genetics Services, Murdoch Childrens Research Institute
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

Based on the classification scheme VCGS_Germline_v1.3.4, this variant is classified as Pathogenic. Following criteria are met: 0102 - Loss of function is a known mechanism of disease in this gene and is associated with acute intermittent porphyria (AIP; MIM#176000). (I) 0107 - This gene is associated with autosomal dominant disease. (I) 0112 - The condition associated with this gene has incomplete penetrance. AIP is a disease with low clinical penetrance, with hormonal changes and commonly used drugs as triggering factors (PMIDs: 33445488, 27539938). (I) 0211 - Canonical splice site variant without proven consequence on splicing (no functional evidence available). (SP) 0251 - This variant is heterozygous. (I) 0301 - Variant is absent from gnomAD (both v2 and v3). (SP) 0505 - Abnormal splicing is predicted by in silico tools and affected nucleotide is highly conserved. (SP) 0701 - Other variants comparable to the one identified in this case have very strong previous evidence for pathogenicity. Multiple variants affecting the same canonical splice donor site, as well as other variants affecting non-canonical nucleotides in the same region, have been reported in patients with acute intermittent porphyria (PMIDs: 31044425, 17298216) . (SP) 0807 - This variant has no previous evidence of pathogenicity. (I) 0905 - No published segregation evidence has been identified for this variant. (I) 1007 - No published functional evidence has been identified for this variant. (I) 1101 - Very strong and specific phenotype match for this individual. (SP) 1206 - This variant has been shown to be paternally inherited (by trio analysis). (I) Legend: (SP) - Supporting pathogenic, (I) - Information, (SB) - Supporting benign -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr11-118955751; API