NM_000256.3:c.2517_2538delCGTGGTGTACGAGATGCGCGTC
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_000256.3(MYBPC3):c.2517_2538delCGTGGTGTACGAGATGCGCGTC(p.Val840ThrfsTer32) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000256.3 frameshift
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 12 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
MYBPC3 | ENST00000545968.6 | c.2517_2538delCGTGGTGTACGAGATGCGCGTC | p.Val840ThrfsTer32 | frameshift_variant | Exon 25 of 35 | 5 | NM_000256.3 | ENSP00000442795.1 | ||
MYBPC3 | ENST00000399249.6 | c.2517_2538delCGTGGTGTACGAGATGCGCGTC | p.Val840ThrfsTer32 | frameshift_variant | Exon 24 of 34 | 5 | ENSP00000382193.2 | |||
MYBPC3 | ENST00000544791.1 | n.*22_*43delCGTGGTGTACGAGATGCGCGTC | non_coding_transcript_exon_variant | Exon 25 of 27 | 5 | ENSP00000444259.1 | ||||
MYBPC3 | ENST00000544791.1 | n.*22_*43delCGTGGTGTACGAGATGCGCGTC | 3_prime_UTR_variant | Exon 25 of 27 | 5 | ENSP00000444259.1 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 genome Cov.: 31
ClinVar
Submissions by phenotype
Hypertrophic cardiomyopathy Pathogenic:1
The Val840fs variant in MYBPC3 has not been reported in individuals with cardiom yopathy. Data from large population studies is insufficient to assess the freque ncy of this variant. This frameshift variant is predicted to alter the protein?s amino acid sequence beginning at position 840 and lead to a premature terminati on codon 32 amino acids downstream. This alteration is then predicted to lead to a truncated or absent protein. Frameshift and other truncating variants in MYBP C3 are established as pathogenic for HCM. In summary, this variant meets our cri teria to be classified as pathogenic (http://pcpgm.partners.org/LMM) based upon the predicted impact of the variant. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at