rs727503187

Variant names:

• chr11-47337454-AGACGCGCATCTCGTACACCACG-A
• rs727503187
• NM_000256.3:c.2517_2538delCGTGGTGTACGAGATGCGCGTC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_000256.3(MYBPC3):​c.2517_2538delCGTGGTGTACGAGATGCGCGTC​(p.Val840ThrfsTer32) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 31)
• Consequence: MYBPC3 NM_000256.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 8.95

Genes affected

MYBPC3 (HGNC:7551): (myosin binding protein C3) MYBPC3 encodes the cardiac isoform of myosin-binding protein C. Myosin-binding protein C is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. MYBPC3 is expressed exclusively in heart muscle and is a key regulator of cardiac contraction. Mutations in this gene are a frequent cause of familial hypertrophic cardiomyopathy. [provided by RefSeq, May 2022]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 11-47337454-AGACGCGCATCTCGTACACCACG-A is Pathogenic according to our data. Variant chr11-47337454-AGACGCGCATCTCGTACACCACG-A is described in ClinVar as [Pathogenic]. Clinvar id is 164073.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr11-47337454-AGACGCGCATCTCGTACACCACG-A is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MYBPC3	NM_000256.3	c.2517_2538delCGTGGTGTACGAGATGCGCGTC	p.Val840ThrfsTer32	frameshift_variant	Exon 25 of 35	ENST00000545968.6	NP_000247.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MYBPC3	ENST00000545968.6	c.2517_2538delCGTGGTGTACGAGATGCGCGTC	p.Val840ThrfsTer32	frameshift_variant	Exon 25 of 35	5	NM_000256.3	ENSP00000442795.1
MYBPC3	ENST00000399249.6	c.2517_2538delCGTGGTGTACGAGATGCGCGTC	p.Val840ThrfsTer32	frameshift_variant	Exon 24 of 34	5		ENSP00000382193.2
MYBPC3	ENST00000544791.1	n.*22_*43delCGTGGTGTACGAGATGCGCGTC		non_coding_transcript_exon_variant	Exon 25 of 27	5		ENSP00000444259.1
MYBPC3	ENST00000544791.1	n.*22_*43delCGTGGTGTACGAGATGCGCGTC		3_prime_UTR_variant	Exon 25 of 27	5		ENSP00000444259.1

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Hypertrophic cardiomyopathy Pathogenic:1

Apr 26, 2013

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The Val840fs variant in MYBPC3 has not been reported in individuals with cardiom yopathy. Data from large population studies is insufficient to assess the freque ncy of this variant. This frameshift variant is predicted to alter the protein?s amino acid sequence beginning at position 840 and lead to a premature terminati on codon 32 amino acids downstream. This alteration is then predicted to lead to a truncated or absent protein. Frameshift and other truncating variants in MYBP C3 are established as pathogenic for HCM. In summary, this variant meets our cri teria to be classified as pathogenic (http://pcpgm.partners.org/LMM) based upon the predicted impact of the variant. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs727503187; hg19: chr11-47359005;