NM_000256.3:c.676_701dupATCACCGATGCCCAGCCTGCCTTCAC
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000256.3(MYBPC3):c.676_701dupATCACCGATGCCCAGCCTGCCTTCAC(p.Gly235SerfsTer74) variant causes a frameshift change. The variant allele was found at a frequency of 0.000000684 in 1,461,294 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000256.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- hypertrophic cardiomyopathyInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- hypertrophic cardiomyopathy 4Inheritance: AD, AR Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae)
- left ventricular noncompaction 10Inheritance: AR, AD Classification: DEFINITIVE, MODERATE, LIMITED Submitted by: Ambry Genetics
- familial isolated dilated cardiomyopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- arrhythmogenic right ventricular cardiomyopathyInheritance: AD Classification: LIMITED Submitted by: ClinGen
- atrial fibrillationInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
- dilated cardiomyopathyInheritance: AD Classification: LIMITED Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
MYBPC3 | ENST00000545968.6 | c.676_701dupATCACCGATGCCCAGCCTGCCTTCAC | p.Gly235SerfsTer74 | frameshift_variant | Exon 6 of 35 | 5 | NM_000256.3 | ENSP00000442795.1 | ||
MYBPC3 | ENST00000399249.6 | c.676_701dupATCACCGATGCCCAGCCTGCCTTCAC | p.Gly235SerfsTer74 | frameshift_variant | Exon 6 of 34 | 5 | ENSP00000382193.2 | |||
MYBPC3 | ENST00000544791.1 | n.676_701dupATCACCGATGCCCAGCCTGCCTTCAC | non_coding_transcript_exon_variant | Exon 6 of 27 | 5 | ENSP00000444259.1 |
Frequencies
GnomAD3 genomes Cov.: 29
GnomAD4 exome AF: 6.84e-7 AC: 1AN: 1461294Hom.: 0 Cov.: 31 AF XY: 0.00 AC XY: 0AN XY: 726908 show subpopulations
Age Distribution
GnomAD4 genome Cov.: 29
ClinVar
Submissions by phenotype
not provided Pathogenic:3
- -
- -
- -
Hypertrophic cardiomyopathy Pathogenic:2
This sequence change creates a premature translational stop signal (p.Gly235Serfs*74) in the MYBPC3 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in MYBPC3 are known to be pathogenic (PMID: 19574547). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with MYBPC3-related conditions. ClinVar contains an entry for this variant (Variation ID: 188532). For these reasons, this variant has been classified as Pathogenic. -
- -
Hypertrophic cardiomyopathy 4 Pathogenic:1
This variant has not been identified in large population databases (Gnomad, 1000 Genomes, Go NL, Exome Variant Server) and is predicted to cause loss of normal protein function either through protein truncation or nonsense-mediated mRNA decay. -
Cardiovascular phenotype Pathogenic:1
PVS1, PS4_mod, PM2 -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at