NM_000256.3:c.676_701dupATCACCGATGCCCAGCCTGCCTTCAC

Variant names:

• chr11-47348494-A-AGTGAAGGCAGGCTGGGCATCGGTGAT
• rs786204329
• NM_000256.3:c.676_701dupATCACCGATGCCCAGCCTGCCTTCAC

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000256.3(MYBPC3):​c.676_701dupATCACCGATGCCCAGCCTGCCTTCAC​(p.Gly235SerfsTer74) variant causes a frameshift change. The variant allele was found at a frequency of 0.000000684 in 1,461,294 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: not found (cov: 29)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
• Consequence: MYBPC3 NM_000256.3 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:7
• Conservation: PhyloP100: 6.68
• Publications: 4 publications found

Genes affected

MYBPC3 (HGNC:7551): (myosin binding protein C3) MYBPC3 encodes the cardiac isoform of myosin-binding protein C. Myosin-binding protein C is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. MYBPC3 is expressed exclusively in heart muscle and is a key regulator of cardiac contraction. Mutations in this gene are a frequent cause of familial hypertrophic cardiomyopathy. [provided by RefSeq, May 2022]

MYBPC3 Gene-Disease associations (from GenCC):

• hypertrophic cardiomyopathy

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• hypertrophic cardiomyopathy 4

  Inheritance: AD, AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• left ventricular noncompaction 10

  Inheritance: AD, AR Classification: DEFINITIVE, MODERATE, LIMITED Submitted by: Ambry Genetics
• familial isolated dilated cardiomyopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• arrhythmogenic right ventricular cardiomyopathy

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen
• atrial fibrillation

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
• congenital heart disease

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen
• dilated cardiomyopathy

  Inheritance: AR, AD Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 11-47348494-A-AGTGAAGGCAGGCTGGGCATCGGTGAT is Pathogenic according to our data. Variant chr11-47348494-A-AGTGAAGGCAGGCTGGGCATCGGTGAT is described in ClinVar as Pathogenic. ClinVar VariationId is 188532.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000256.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MYBPC3	NM_000256.3	MANE Select	c.676_701dupATCACCGATGCCCAGCCTGCCTTCAC	p.Gly235SerfsTer74	frameshift	Exon 6 of 35	NP_000247.2	Q14896-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MYBPC3	ENST00000545968.6	TSL:5 MANE Select	c.676_701dupATCACCGATGCCCAGCCTGCCTTCAC	p.Gly235SerfsTer74	frameshift	Exon 6 of 35	ENSP00000442795.1	Q14896-1
	MYBPC3	ENST00000399249.6	TSL:5	c.676_701dupATCACCGATGCCCAGCCTGCCTTCAC	p.Gly235SerfsTer74	frameshift	Exon 6 of 34	ENSP00000382193.2	A8MXZ9
	MYBPC3	ENST00000544791.1	TSL:5	n.676_701dupATCACCGATGCCCAGCCTGCCTTCAC		non_coding_transcript_exon	Exon 6 of 27	ENSP00000444259.1	F5GZR4

Frequencies

GnomAD3 genomes Cov.: 29

GnomAD4 exome AF: 6.84e-7 AC: 1 AN: 1461294 Hom.: 0 Cov.: 31 AF XY: 0.00 AC XY: 0 AN XY: 726908

African (AFR) AF: 0.00 AC: 0 AN: 33476

American (AMR) AF: 0.00 AC: 0 AN: 44674

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26132

East Asian (EAS) AF: 0.00 AC: 0 AN: 39694

South Asian (SAS) AF: 0.00 AC: 0 AN: 86160

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53340

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 9.00e-7 AC: 1 AN: 1111690

Other (OTH) AF: 0.00 AC: 0 AN: 60360

GnomAD4 genome Cov.: 29

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
3	-	-	not provided (3)
2	-	-	Hypertrophic cardiomyopathy (2)
1	-	-	Cardiovascular phenotype (1)
1	-	-	Hypertrophic cardiomyopathy 4 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.7
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs786204329; hg19: chr11-47370045;