NM_000256.3:c.676_701dupATCACCGATGCCCAGCCTGCCTTCAC
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000256.3(MYBPC3):c.676_701dupATCACCGATGCCCAGCCTGCCTTCAC(p.Gly235SerfsTer74) variant causes a frameshift change. The variant allele was found at a frequency of 0.000000684 in 1,461,294 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000256.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- hypertrophic cardiomyopathyInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- hypertrophic cardiomyopathy 4Inheritance: AD, AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- left ventricular noncompaction 10Inheritance: AD, AR Classification: DEFINITIVE, MODERATE, LIMITED Submitted by: Ambry Genetics
- familial isolated dilated cardiomyopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- arrhythmogenic right ventricular cardiomyopathyInheritance: AD Classification: LIMITED Submitted by: ClinGen
- atrial fibrillationInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
- congenital heart diseaseInheritance: AD Classification: LIMITED Submitted by: ClinGen
- dilated cardiomyopathyInheritance: AR, AD Classification: LIMITED Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000256.3. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MYBPC3 | TSL:5 MANE Select | c.676_701dupATCACCGATGCCCAGCCTGCCTTCAC | p.Gly235SerfsTer74 | frameshift | Exon 6 of 35 | ENSP00000442795.1 | Q14896-1 | ||
| MYBPC3 | TSL:5 | c.676_701dupATCACCGATGCCCAGCCTGCCTTCAC | p.Gly235SerfsTer74 | frameshift | Exon 6 of 34 | ENSP00000382193.2 | A8MXZ9 | ||
| MYBPC3 | TSL:5 | n.676_701dupATCACCGATGCCCAGCCTGCCTTCAC | non_coding_transcript_exon | Exon 6 of 27 | ENSP00000444259.1 | F5GZR4 |
Frequencies
GnomAD3 genomes Cov.: 29
GnomAD4 exome AF: 6.84e-7 AC: 1AN: 1461294Hom.: 0 Cov.: 31 AF XY: 0.00 AC XY: 0AN XY: 726908 show subpopulations
Age Distribution
GnomAD4 genome Cov.: 29
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at