rs786204329

Variant names:

• chr11-47348494-A-AGTGAAGGCAGGCTGGGCATCGGTGAT
• rs786204329
• NM_000256.3:c.676_701dupATCACCGATGCCCAGCCTGCCTTCAC

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_000256.3(MYBPC3):​c.676_701dupATCACCGATGCCCAGCCTGCCTTCAC​(p.Gly235SerfsTer74) variant causes a frameshift change. The variant allele was found at a frequency of 0.000000684 in 1,461,294 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: not found (cov: 29)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
• Consequence: MYBPC3 NM_000256.3 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:7
• Conservation: PhyloP100: 6.68

Genes affected

MYBPC3 (HGNC:7551): (myosin binding protein C3) MYBPC3 encodes the cardiac isoform of myosin-binding protein C. Myosin-binding protein C is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. MYBPC3 is expressed exclusively in heart muscle and is a key regulator of cardiac contraction. Mutations in this gene are a frequent cause of familial hypertrophic cardiomyopathy. [provided by RefSeq, May 2022]

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 11-47348494-A-AGTGAAGGCAGGCTGGGCATCGGTGAT is Pathogenic according to our data. Variant chr11-47348494-A-AGTGAAGGCAGGCTGGGCATCGGTGAT is described in ClinVar as [Pathogenic]. Clinvar id is 188532.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MYBPC3	NM_000256.3	c.676_701dupATCACCGATGCCCAGCCTGCCTTCAC	p.Gly235SerfsTer74	frameshift_variant	Exon 6 of 35	ENST00000545968.6	NP_000247.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MYBPC3	ENST00000545968.6	c.676_701dupATCACCGATGCCCAGCCTGCCTTCAC	p.Gly235SerfsTer74	frameshift_variant	Exon 6 of 35	5	NM_000256.3	ENSP00000442795.1
MYBPC3	ENST00000399249.6	c.676_701dupATCACCGATGCCCAGCCTGCCTTCAC	p.Gly235SerfsTer74	frameshift_variant	Exon 6 of 34	5		ENSP00000382193.2
MYBPC3	ENST00000544791.1	n.676_701dupATCACCGATGCCCAGCCTGCCTTCAC		non_coding_transcript_exon_variant	Exon 6 of 27	5		ENSP00000444259.1

Frequencies

GnomAD3 genomes Cov.: 29

GnomAD4 exome AF: 6.84e-7 AC: 1 AN: 1461294 Hom.: 0 Cov.: 31 AF XY: 0.00 AC XY: 0 AN XY: 726908

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 9.00e-7

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 29

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:7

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Pathogenic:3

-

Joint Genome Diagnostic Labs from Nijmegen and Maastricht, Radboudumc and MUMC+

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

-

Clinical Genetics, Academic Medical Center

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

-

Genome Diagnostics Laboratory, University Medical Center Utrecht

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

Hypertrophic cardiomyopathy Pathogenic:2

Oct 31, 2018

Center for Human Genetics, University of Leuven

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

May 23, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Gly235Serfs*74) in the MYBPC3 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in MYBPC3 are known to be pathogenic (PMID: 19574547). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with MYBPC3-related conditions. ClinVar contains an entry for this variant (Variation ID: 188532). For these reasons, this variant has been classified as Pathogenic. -

Hypertrophic cardiomyopathy 4 Pathogenic:1

Jan 01, 2016

Center for Medical Genetics Ghent, University of Ghent

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant has not been identified in large population databases (Gnomad, 1000 Genomes, Go NL, Exome Variant Server) and is predicted to cause loss of normal protein function either through protein truncation or nonsense-mediated mRNA decay. -

Cardiovascular phenotype Pathogenic:1

Nov 08, 2024

Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease, Montreal Heart Institute

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

PVS1, PS4_mod, PM2 -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs786204329; hg19: chr11-47370045;