NM_000264.5:c.4014_4034delCTGGGGCCCTCGCGGGGCCCG

Variant names:

• chr9-95447221-ACGGGCCCCGCGAGGGCCCCAG-A
• rs774819810
• NM_000264.5:c.4014_4034delCTGGGGCCCTCGCGGGGCCCG

Variant summary

Our verdict is Benign. The variant received -7 ACMG points: 2P and 9B. PM4 BP6 BS1 BS2

The NM_000264.5(PTCH1):​c.4014_4034delCTGGGGCCCTCGCGGGGCCCG​(p.Trp1339_Arg1345del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000424 in 1,612,766 control chromosomes in the GnomAD database, including 2 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. R1338R) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.00015 (0 hom., cov: 32)
  • Exomes 𝑓: 0.00045 (2 hom.)
• Consequence: PTCH1 NM_000264.5 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:3 B:4
• Conservation: PhyloP100: 5.65
• Publications: 2 publications found

Genes affected

PTCH1 (HGNC:9585): (patched 1) This gene encodes a member of the patched family of proteins and a component of the hedgehog signaling pathway. Hedgehog signaling is important in embryonic development and tumorigenesis. The encoded protein is the receptor for the secreted hedgehog ligands, which include sonic hedgehog, indian hedgehog and desert hedgehog. Following binding by one of the hedgehog ligands, the encoded protein is trafficked away from the primary cilium, relieving inhibition of the G-protein-coupled receptor smoothened, which results in activation of downstream signaling. Mutations of this gene have been associated with basal cell nevus syndrome and holoprosencephaly. [provided by RefSeq, Aug 2017]

PTCH1 Gene-Disease associations (from GenCC):

• basal cell nevus syndrome 1

  Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
• holoprosencephaly 7

  Inheritance: AD Classification: DEFINITIVE, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P
• nevoid basal cell carcinoma syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, ClinGen, Labcorp Genetics (formerly Invitae), Orphanet
• holoprosencephaly

  Inheritance: AD Classification: LIMITED Submitted by: Illumina

ACMG classification

Our verdict: Benign. The variant received -7 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000264.5.
• BP6: Variant 9-95447221-ACGGGCCCCGCGAGGGCCCCAG-A is Benign according to our data. Variant chr9-95447221-ACGGGCCCCGCGAGGGCCCCAG-A is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 219471.
• BS1: Variant frequency is greater than expected in population nfe. GnomAdExome4 allele frequency = 0.000453 (661/1460580) while in subpopulation NFE AF = 0.00057 (634/1111858). AF 95% confidence interval is 0.000533. There are 2 homozygotes in GnomAdExome4. There are 306 alleles in the male GnomAdExome4 subpopulation. This position passed quality control check.
• BS2: High AC in GnomAd4 at 23 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000264.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PTCH1	NM_000264.5	MANE Select	c.4014_4034delCTGGGGCCCTCGCGGGGCCCG	p.Trp1339_Arg1345del	disruptive_inframe_deletion	Exon 23 of 24	NP_000255.2
	PTCH1	NM_001083603.3	MANE Plus Clinical	c.4011_4031delCTGGGGCCCTCGCGGGGCCCG	p.Trp1338_Arg1344del	disruptive_inframe_deletion	Exon 23 of 24	NP_001077072.1
	PTCH1	NM_001354918.2		c.3858_3878delCTGGGGCCCTCGCGGGGCCCG	p.Trp1287_Arg1293del	disruptive_inframe_deletion	Exon 22 of 23	NP_001341847.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PTCH1	ENST00000331920.11	TSL:5 MANE Select	c.4014_4034delCTGGGGCCCTCGCGGGGCCCG	p.Trp1339_Arg1345del	disruptive_inframe_deletion	Exon 23 of 24	ENSP00000332353.6
	PTCH1	ENST00000437951.6	TSL:5 MANE Plus Clinical	c.4011_4031delCTGGGGCCCTCGCGGGGCCCG	p.Trp1338_Arg1344del	disruptive_inframe_deletion	Exon 23 of 24	ENSP00000389744.2
	PTCH1	ENST00000429896.6	TSL:1	c.3561_3581delCTGGGGCCCTCGCGGGGCCCG	p.Trp1188_Arg1194del	disruptive_inframe_deletion	Exon 23 of 24	ENSP00000414823.2

Frequencies

GnomAD3 genomes AF: 0.000151 AC: 23 AN: 152186 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000483

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000309

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.000150 AC: 37 AN: 246172 AF XY: 0.000141

Gnomad AFR exome AF: 0.0000665

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000165

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000263

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.000453 AC: 661 AN: 1460580 Hom.: 2 AF XY: 0.000421 AC XY: 306 AN XY: 726600

African (AFR) AF: 0.000149 AC: 5 AN: 33480

American (AMR) AF: 0.00 AC: 0 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26130

East Asian (EAS) AF: 0.0000504 AC: 2 AN: 39700

South Asian (SAS) AF: 0.0000927 AC: 8 AN: 86254

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52306

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5764

European-Non Finnish (NFE) AF: 0.000570 AC: 634 AN: 1111858

Other (OTH) AF: 0.000199 AC: 12 AN: 60364

GnomAD4 genome AF: 0.000151 AC: 23 AN: 152186 Hom.: 0 Cov.: 32 AF XY: 0.0000942 AC XY: 7 AN XY: 74346

African (AFR) AF: 0.0000483 AC: 2 AN: 41450

American (AMR) AF: 0.00 AC: 0 AN: 15290

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5176

South Asian (SAS) AF: 0.00 AC: 0 AN: 4832

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10624

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.000309 AC: 21 AN: 68024

Other (OTH) AF: 0.00 AC: 0 AN: 2092

Alfa AF: 0.000130 Hom.: 0

Bravo AF: 0.000178

ClinVar

ClinVar submissions as Germline

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
-	-	2	Hereditary cancer-predisposing syndrome (2)
-	-	1	Gorlin syndrome (1)
-	1	-	Holoprosencephaly 7;C2751544:Basal cell carcinoma, susceptibility to, 1;CN376810:Basal cell nevus syndrome 1 (1)
-	-	1	Intellectual disability (1)
-	1	-	not provided (1)
-	1	-	PTCH1-related disorder (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.6
Mutation Taster		=0/200	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs774819810; hg19: chr9-98209503; COSMIC: COSV59468899;