rs774819810

Variant names:

• chr9-95447221-ACGGGCCCCGCGAGGGCCCCAG-A
• rs774819810
• NM_000264.5:c.4014_4034delCTGGGGCCCTCGCGGGGCCCG

Variant summary

Our verdict is Benign. Variant got -7 ACMG points: 2P and 9B. PM4 BP6 BS1 BS2

The NM_000264.5(PTCH1):​c.4014_4034delCTGGGGCCCTCGCGGGGCCCG​(p.Trp1339_Arg1345del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000424 in 1,612,766 control chromosomes in the GnomAD database, including 2 homozygotes. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.00015 (0 hom., cov: 32)
  • Exomes 𝑓: 0.00045 (2 hom.)
• Consequence: PTCH1 NM_000264.5 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:3 B:3
• Conservation: PhyloP100: 5.65

Genes affected

PTCH1 (HGNC:9585): (patched 1) This gene encodes a member of the patched family of proteins and a component of the hedgehog signaling pathway. Hedgehog signaling is important in embryonic development and tumorigenesis. The encoded protein is the receptor for the secreted hedgehog ligands, which include sonic hedgehog, indian hedgehog and desert hedgehog. Following binding by one of the hedgehog ligands, the encoded protein is trafficked away from the primary cilium, relieving inhibition of the G-protein-coupled receptor smoothened, which results in activation of downstream signaling. Mutations of this gene have been associated with basal cell nevus syndrome and holoprosencephaly. [provided by RefSeq, Aug 2017]

ACMG classification

Verdict is Benign. Variant got -7 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000264.5.
• BP6: Variant 9-95447221-ACGGGCCCCGCGAGGGCCCCAG-A is Benign according to our data. Variant chr9-95447221-ACGGGCCCCGCGAGGGCCCCAG-A is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 219471.We mark this variant Likely_benign, oryginal submissions are: {Likely_benign=1, Benign=2, Uncertain_significance=2}.
• BS1: Variant frequency is greater than expected in population nfe. gnomad4_exome allele frequency = 0.000453 (661/1460580) while in subpopulation NFE AF= 0.00057 (634/1111858). AF 95% confidence interval is 0.000533. There are 2 homozygotes in gnomad4_exome. There are 306 alleles in male gnomad4_exome subpopulation. This position pass quality control queck.
• BS2: High AC in GnomAd4 at 23 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PTCH1	NM_000264.5	c.4014_4034delCTGGGGCCCTCGCGGGGCCCG	p.Trp1339_Arg1345del	disruptive_inframe_deletion	Exon 23 of 24	ENST00000331920.11	NP_000255.2
PTCH1	NM_001083603.3	c.4011_4031delCTGGGGCCCTCGCGGGGCCCG	p.Trp1338_Arg1344del	disruptive_inframe_deletion	Exon 23 of 24	ENST00000437951.6	NP_001077072.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PTCH1	ENST00000331920.11	c.4014_4034delCTGGGGCCCTCGCGGGGCCCG	p.Trp1339_Arg1345del	disruptive_inframe_deletion	Exon 23 of 24	5	NM_000264.5	ENSP00000332353.6
PTCH1	ENST00000437951.6	c.4011_4031delCTGGGGCCCTCGCGGGGCCCG	p.Trp1338_Arg1344del	disruptive_inframe_deletion	Exon 23 of 24	5	NM_001083603.3	ENSP00000389744.2

Frequencies

GnomAD3 genomes AF: 0.000151 AC: 23 AN: 152186 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000483

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000309

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.000150 AC: 37 AN: 246172 Hom.: 0 AF XY: 0.000141 AC XY: 19 AN XY: 134338

Gnomad AFR exome AF: 0.0000665

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000165

Gnomad SAS exome AF: 0.000131

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000263

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.000453 AC: 661 AN: 1460580 Hom.: 2 AF XY: 0.000421 AC XY: 306 AN XY: 726600

Gnomad4 AFR exome AF: 0.000149

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000504

Gnomad4 SAS exome AF: 0.0000927

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.000570

Gnomad4 OTH exome AF: 0.000199

GnomAD4 genome AF: 0.000151 AC: 23 AN: 152186 Hom.: 0 Cov.: 32 AF XY: 0.0000942 AC XY: 7 AN XY: 74346

Gnomad4 AFR AF: 0.0000483

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000309

Gnomad4 OTH AF: 0.00

Alfa AF: 0.000130 Hom.: 0

Bravo AF: 0.000178

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:3 Benign:3

Revision: criteria provided, conflicting classifications

Submissions by phenotype

Hereditary cancer-predisposing syndrome Benign:2

Mar 17, 2021

Ambry Genetics

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This alteration is classified as benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -

Sep 23, 2021

Sema4, Sema4

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: curation

- -

PTCH1-related disorder Uncertain:1

Aug 12, 2024

PreventionGenetics, part of Exact Sciences

Significance: Uncertain significance

Review Status: no assertion criteria provided

Collection Method: clinical testing

The PTCH1 c.4014_4034del21 variant is predicted to result in an in-frame deletion (p.Trp1339_Arg1345del). This variant was reported in the heterozygous state a 5-year-old boy with overgrowth, macrocephaly, and autism; however inheritance is unknown as parental samples were not available for testing (Klein et al. 2019. PubMed ID: 31639285). This variant is reported in 0.025% of alleles in individuals of European (Non-Finnish) descent in gnomAD, which may be too common to be a primary cause of disease. This variant has conflicting classifications of pathogenicity in ClinVar ranging from benign to uncertain significance (https://www.ncbi.nlm.nih.gov/clinvar/variation/219471/). Although we suspect that this variant may be benign, at this time, the clinical significance of this variant is uncertain due to the absence of conclusive functional and genetic evidence. -

not provided Uncertain:1

Feb 01, 2022

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In-frame deletion of 7 amino acids in a non-repeat region; In silico analysis supports a deleterious effect on protein structure/function; Reported in a child with overgrowth and autism spectrum disorder (Klein et al., 2019); This variant is associated with the following publications: (PMID: 31639285) -

Holoprosencephaly 7;C2751544:Basal cell carcinoma, susceptibility to, 1;CN376810:Basal cell nevus syndrome 1 Uncertain:1

Jan 05, 2024

Fulgent Genetics, Fulgent Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Gorlin syndrome Benign:1

Jan 31, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs774819810; hg19: chr9-98209503;