NM_000344.4:c.724_834del

Variant names:

• chr5-70946064-AGATAATTCCCCCACCACCTCCCATATGTCCAGATTCTCTTGATGATGCTGATGCTTTGGGAAGTATGTTAATTTCATGGTACATGAGTGGCTATCATACTGGCTATTATAT-A
• rs1554082110
• NM_000344.4:c.724_834del

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PP3 PP5

The NM_000344.4(SMN1):​c.724_834del variant causes a exon loss, splice region change involving the alteration of a conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 0)
• Consequence: SMN1 NM_000344.4 exon_loss, splice_region
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 9.11
• Publications: 0 publications found

Genes affected

SMN1 (HGNC:11117): (survival of motor neuron 1, telomeric) This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. The telomeric and centromeric copies of this gene are nearly identical and encode the same protein. However, mutations in this gene, the telomeric copy, are associated with spinal muscular atrophy; mutations in the centromeric copy do not lead to disease. The centromeric copy may be a modifier of disease caused by mutation in the telomeric copy. The critical sequence difference between the two genes is a single nucleotide in exon 7, which is thought to be an exon splice enhancer. Note that the nine exons of both the telomeric and centromeric copies are designated historically as exon 1, 2a, 2b, and 3-8. It is thought that gene conversion events may involve the two genes, leading to varying copy numbers of each gene. The protein encoded by this gene localizes to both the cytoplasm and the nucleus. Within the nucleus, the protein localizes to subnuclear bodies called gems which are found near coiled bodies containing high concentrations of small ribonucleoproteins (snRNPs). This protein forms heteromeric complexes with proteins such as SIP1 and GEMIN4, and also interacts with several proteins known to be involved in the biogenesis of snRNPs, such as hnRNP U protein and the small nucleolar RNA binding protein. Multiple transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2014]

SMN1 Gene-Disease associations (from GenCC):

• spinal muscular atrophy

  Inheritance: AR Classification: DEFINITIVE Submitted by: Myriad Women’s Health
• spinal muscular atrophy, type 1

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, PanelApp Australia, Genomics England PanelApp, Orphanet
• spinal muscular atrophy, type II

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet
• spinal muscular atrophy, type III

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet
• spinal muscular atrophy, type IV

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 5-70946064-AGATAATTCCCCCACCACCTCCCATATGTCCAGATTCTCTTGATGATGCTGATGCTTTGGGAAGTATGTTAATTTCATGGTACATGAGTGGCTATCATACTGGCTATTATAT-A is Pathogenic according to our data. Variant chr5-70946064-AGATAATTCCCCCACCACCTCCCATATGTCCAGATTCTCTTGATGATGCTGATGCTTTGGGAAGTATGTTAATTTCATGGTACATGAGTGGCTATCATACTGGCTATTATAT-A is described in ClinVar as Pathogenic. ClinVar VariationId is 431179.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000344.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SMN1	NM_000344.4	MANE Select	c.724_834del		exon_loss splice_region	Exon 7 of 9	NP_000335.1	Q16637-1
	SMN1	NM_001297715.1		c.724_834del		exon_loss splice_region	Exon 7 of 8	NP_001284644.1	Q16637-3
	SMN1	NM_022874.2		c.628_738del		exon_loss splice_region	Exon 6 of 8	NP_075012.1	Q16637-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SMN1	ENST00000380707.9	TSL:1 MANE Select	c.724-1_833del	p.Ile242fs	frameshift splice_acceptor splice_region intron	Exon 7 of 9	ENSP00000370083.4	Q16637-1
	SMN1	ENST00000351205.8	TSL:1	c.724-1_833del	p.Ile242fs	frameshift splice_acceptor splice_region intron	Exon 7 of 8	ENSP00000305857.5	Q16637-1
	SMN1	ENST00000506163.5	TSL:1	c.724-1_833del	p.Ile242fs	frameshift splice_acceptor splice_region intron	Exon 7 of 8	ENSP00000424926.1	Q16637-3

Frequencies

GnomAD3 genomes Cov.: 0

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 0

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Kugelberg-Welander disease;C0393538:Spinal muscular atrophy, type II;C1838230:Spinal muscular atrophy, type IV;C5848259:Werdnig-Hoffmann disease (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.1
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554082110; hg19: chr5-70241891;