NM_000421.5:c.1428_1457dupAAGCTCCGGCGGCGGAAGCTCCGGCGGCGG
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 2P and 2B. PM4BP6_Moderate
The NM_000421.5(KRT10):c.1428_1457dupAAGCTCCGGCGGCGGAAGCTCCGGCGGCGG(p.Gly486_His487insSerSerGlyGlyGlySerSerGlyGlyGly) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).
Frequency
Consequence
NM_000421.5 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000421.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KRT10 | MANE Select | c.1428_1457dupAAGCTCCGGCGGCGGAAGCTCCGGCGGCGG | p.Gly486_His487insSerSerGlyGlyGlySerSerGlyGlyGly | disruptive_inframe_insertion | Exon 7 of 8 | NP_000412.4 | |||
| KRT10 | c.1428_1457dupAAGCTCCGGCGGCGGAAGCTCCGGCGGCGG | p.Gly486_His487insSerSerGlyGlyGlySerSerGlyGlyGly | disruptive_inframe_insertion | Exon 7 of 8 | NP_001366295.1 | A0A1B0GVI3 | |||
| KRT10-AS1 | n.-108_-107insCCGCCGCCGGAGCTTCCGCCGCCGGAGCTT | upstream_gene | N/A |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KRT10 | TSL:1 MANE Select | c.1428_1457dupAAGCTCCGGCGGCGGAAGCTCCGGCGGCGG | p.Gly486_His487insSerSerGlyGlyGlySerSerGlyGlyGly | disruptive_inframe_insertion | Exon 7 of 8 | ENSP00000269576.5 | P13645 | ||
| KRT10 | TSL:2 | c.1428_1457dupAAGCTCCGGCGGCGGAAGCTCCGGCGGCGG | p.Gly486_His487insSerSerGlyGlyGlySerSerGlyGlyGly | disruptive_inframe_insertion | Exon 7 of 8 | ENSP00000490524.2 | A0A1B0GVI3 | ||
| KRT10-AS1 | TSL:2 | n.-11_19dupGAGCTTCCGCCGCCGGAGCTTCCGCCGCCG | non_coding_transcript_exon | Exon 1 of 3 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 exome Cov.: 34
GnomAD4 genome Cov.: 31
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.