NM_000426.4:c.397-4_478delCTAGGTGTTCCAGATCGCGTATGTGATTGTGAAGGCAGCTAACTCCCCCCGGCCTGGAAACTGGATTTTGGAACGCTCTCTTGATG

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate

The NM_000426.4(LAMA2):​c.397-4_478delCTAGGTGTTCCAGATCGCGTATGTGATTGTGAAGGCAGCTAACTCCCCCCGGCCTGGAAACTGGATTTTGGAACGCTCTCTTGATG​(p.Val133fs) variant causes a frameshift, splice acceptor, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

LAMA2
NM_000426.4 frameshift, splice_acceptor, splice_region, intron

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 6.25

Publications

0 publications found
Variant links:
Genes affected
LAMA2 (HGNC:6482): (laminin subunit alpha 2) Laminin, an extracellular protein, is a major component of the basement membrane. It is thought to mediate the attachment, migration, and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. It is composed of three subunits, alpha, beta, and gamma, which are bound to each other by disulfide bonds into a cross-shaped molecule. This gene encodes the alpha 2 chain, which constitutes one of the subunits of laminin 2 (merosin) and laminin 4 (s-merosin). Mutations in this gene have been identified as the cause of congenital merosin-deficient muscular dystrophy. Two transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
LAMA2 Gene-Disease associations (from GenCC):
  • congenital merosin-deficient muscular dystrophy 1A
    Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Myriad Women’s Health, G2P
  • LAMA2-related muscular dystrophy
    Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
  • muscular dystrophy, limb-girdle, autosomal recessive 23
    Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 10 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 6-129098168-CCTAGGTGTTCCAGATCGCGTATGTGATTGTGAAGGCAGCTAACTCCCCCCGGCCTGGAAACTGGATTTTGGAACGCTCTCTTGATG-C is Pathogenic according to our data. Variant chr6-129098168-CCTAGGTGTTCCAGATCGCGTATGTGATTGTGAAGGCAGCTAACTCCCCCCGGCCTGGAAACTGGATTTTGGAACGCTCTCTTGATG-C is described in ClinVar as Pathogenic. ClinVar VariationId is 437434.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
LAMA2NM_000426.4 linkc.397-4_478delCTAGGTGTTCCAGATCGCGTATGTGATTGTGAAGGCAGCTAACTCCCCCCGGCCTGGAAACTGGATTTTGGAACGCTCTCTTGATG p.Val133fs frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant Exon 4 of 65 ENST00000421865.3 NP_000417.3
LAMA2NM_001079823.2 linkc.397-4_478delCTAGGTGTTCCAGATCGCGTATGTGATTGTGAAGGCAGCTAACTCCCCCCGGCCTGGAAACTGGATTTTGGAACGCTCTCTTGATG p.Val133fs frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant Exon 4 of 64 NP_001073291.2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
LAMA2ENST00000421865.3 linkc.397-4_478delCTAGGTGTTCCAGATCGCGTATGTGATTGTGAAGGCAGCTAACTCCCCCCGGCCTGGAAACTGGATTTTGGAACGCTCTCTTGATG p.Val133fs frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant Exon 4 of 65 5 NM_000426.4 ENSP00000400365.2 P24043

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Merosin deficient congenital muscular dystrophy Pathogenic:1
Jun 07, 2017
Genomic Research Center, Shahid Beheshti University of Medical Sciences
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
6.2
Mutation Taster
=0/200
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1554217494; hg19: chr6-129419313; API