rs1554217494

Variant names:

• chr6-129098168-CCTAGGTGTTCCAGATCGCGTATGTGATTGTGAAGGCAGCTAACTCCCCCCGGCCTGGAAACTGGATTTTGGAACGCTCTCTTGATG-C
• rs1554217494
• NM_000426.4:c.397-4_478delCTAGGTGTTCCAGATCGCGTATGTGATTGTGAAGGCAGCTAACTCCCCCCGGCCTGGAAACTGGATTTTGGAACGCTCTCTTGATG

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_000426.4(LAMA2):​c.397-4_478delCTAGGTGTTCCAGATCGCGTATGTGATTGTGAAGGCAGCTAACTCCCCCCGGCCTGGAAACTGGATTTTGGAACGCTCTCTTGATG​(p.Val133fs) variant causes a frameshift, splice acceptor, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: LAMA2 NM_000426.4 frameshift, splice_acceptor, splice_region, intron
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 6.25
• Publications: 0 publications found

Genes affected

LAMA2 (HGNC:6482): (laminin subunit alpha 2) Laminin, an extracellular protein, is a major component of the basement membrane. It is thought to mediate the attachment, migration, and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. It is composed of three subunits, alpha, beta, and gamma, which are bound to each other by disulfide bonds into a cross-shaped molecule. This gene encodes the alpha 2 chain, which constitutes one of the subunits of laminin 2 (merosin) and laminin 4 (s-merosin). Mutations in this gene have been identified as the cause of congenital merosin-deficient muscular dystrophy. Two transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Jul 2008]

LAMA2 Gene-Disease associations (from GenCC):

• congenital merosin-deficient muscular dystrophy 1A

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Myriad Women’s Health, G2P
• LAMA2-related muscular dystrophy

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• muscular dystrophy, limb-girdle, autosomal recessive 23

  Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 6-129098168-CCTAGGTGTTCCAGATCGCGTATGTGATTGTGAAGGCAGCTAACTCCCCCCGGCCTGGAAACTGGATTTTGGAACGCTCTCTTGATG-C is Pathogenic according to our data. Variant chr6-129098168-CCTAGGTGTTCCAGATCGCGTATGTGATTGTGAAGGCAGCTAACTCCCCCCGGCCTGGAAACTGGATTTTGGAACGCTCTCTTGATG-C is described in ClinVar as Pathogenic. ClinVar VariationId is 437434.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
LAMA2	NM_000426.4	c.397-4_478delCTAGGTGTTCCAGATCGCGTATGTGATTGTGAAGGCAGCTAACTCCCCCCGGCCTGGAAACTGGATTTTGGAACGCTCTCTTGATG	p.Val133fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 4 of 65	ENST00000421865.3	NP_000417.3
LAMA2	NM_001079823.2	c.397-4_478delCTAGGTGTTCCAGATCGCGTATGTGATTGTGAAGGCAGCTAACTCCCCCCGGCCTGGAAACTGGATTTTGGAACGCTCTCTTGATG	p.Val133fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 4 of 64		NP_001073291.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
LAMA2	ENST00000421865.3	c.397-4_478delCTAGGTGTTCCAGATCGCGTATGTGATTGTGAAGGCAGCTAACTCCCCCCGGCCTGGAAACTGGATTTTGGAACGCTCTCTTGATG	p.Val133fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 4 of 65	5	NM_000426.4	ENSP00000400365.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Merosin deficient congenital muscular dystrophy Pathogenic:1

Jun 07, 2017

Genomic Research Center, Shahid Beheshti University of Medical Sciences

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.2
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554217494; hg19: chr6-129419313;