rs1554217494

Positions:

• chr6-129098168-CCTAGGTGTTCCAGATCGCGTATGTGATTGTGAAGGCAGCTAACTCCCCCCGGCCTGGAAACTGGATTTTGGAACGCTCTCTTGATG-C

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_000426.4(LAMA2):​c.397-4_478delCTAGGTGTTCCAGATCGCGTATGTGATTGTGAAGGCAGCTAACTCCCCCCGGCCTGGAAACTGGATTTTGGAACGCTCTCTTGATG​(p.Val133fs) variant causes a frameshift, splice acceptor, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: LAMA2 NM_000426.4 frameshift, splice_acceptor, splice_region, intron
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 6.25

Genes affected

LAMA2 (HGNC:6482): (laminin subunit alpha 2) Laminin, an extracellular protein, is a major component of the basement membrane. It is thought to mediate the attachment, migration, and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. It is composed of three subunits, alpha, beta, and gamma, which are bound to each other by disulfide bonds into a cross-shaped molecule. This gene encodes the alpha 2 chain, which constitutes one of the subunits of laminin 2 (merosin) and laminin 4 (s-merosin). Mutations in this gene have been identified as the cause of congenital merosin-deficient muscular dystrophy. Two transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Jul 2008]

LAMA2 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 6-129098168-CCTAGGTGTTCCAGATCGCGTATGTGATTGTGAAGGCAGCTAACTCCCCCCGGCCTGGAAACTGGATTTTGGAACGCTCTCTTGATG-C is Pathogenic according to our data. Variant chr6-129098168-CCTAGGTGTTCCAGATCGCGTATGTGATTGTGAAGGCAGCTAACTCCCCCCGGCCTGGAAACTGGATTTTGGAACGCTCTCTTGATG-C is described in ClinVar as [Pathogenic]. Clinvar id is 437434.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
LAMA2	NM_000426.4	c.397-4_478delCTAGGTGTTCCAGATCGCGTATGTGATTGTGAAGGCAGCTAACTCCCCCCGGCCTGGAAACTGGATTTTGGAACGCTCTCTTGATG	p.Val133fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	4/65	ENST00000421865.3	NP_000417.3
LAMA2	NM_001079823.2	c.397-4_478delCTAGGTGTTCCAGATCGCGTATGTGATTGTGAAGGCAGCTAACTCCCCCCGGCCTGGAAACTGGATTTTGGAACGCTCTCTTGATG	p.Val133fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	4/64		NP_001073291.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
LAMA2	ENST00000421865.3	c.397-4_478delCTAGGTGTTCCAGATCGCGTATGTGATTGTGAAGGCAGCTAACTCCCCCCGGCCTGGAAACTGGATTTTGGAACGCTCTCTTGATG	p.Val133fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	4/65	5	NM_000426.4	ENSP00000400365.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Merosin deficient congenital muscular dystrophy Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Genomic Research Center, Shahid Beheshti University of Medical Sciences

Jun 07, 2017

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554217494; hg19: chr6-129419313;