NM_000435.3:c.714_758delCGACTGTCCAGGACACCGATGTCTCAATGGGGGGACATGCGTGGA

Variant names:

• chr19-15191788-ATCCACGCATGTCCCCCCATTGAGACATCGGTGTCCTGGACAGTCG-A
• rs864621965
• NM_000435.3:c.714_758delCGACTGTCCAGGACACCGATGTCTCAATGGGGGGACATGCGTGGA

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PM1 PM4 PP3 PP5

The NM_000435.3(NOTCH3):​c.714_758delCGACTGTCCAGGACACCGATGTCTCAATGGGGGGACATGCGTGGA​(p.Asp239_Asp253del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. D238D) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 33)
• Consequence: NOTCH3 NM_000435.3 disruptive_inframe_deletion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 9.25
• Publications: 1 publications found

Genes affected

NOTCH3 (HGNC:7883): (notch receptor 3) This gene encodes the third discovered human homologue of the Drosophilia melanogaster type I membrane protein notch. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signalling pathway that plays a key role in neural development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remains to be determined. Mutations in NOTCH3 have been identified as the underlying cause of cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). [provided by RefSeq, Jul 2008]

NOTCH3 Gene-Disease associations (from GenCC):

• cerebral arteriopathy, autosomal dominant, with subcortical infarcts and leukoencephalopathy, type 1

  Inheritance: AR, AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Genomics England PanelApp, Laboratory for Molecular Medicine, Orphanet, Labcorp Genetics (formerly Invitae)
• lateral meningocele syndrome

  Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)
• infantile myofibromatosis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• myofibromatosis, infantile, 2

  Inheritance: AD Classification: LIMITED Submitted by: G2P
• pulmonary arterial hypertension

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

• PM1: In a hotspot region, there are 7 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 1 benign, 6 uncertain in NM_000435.3
• PM4: Nonframeshift variant in NON repetitive region in NM_000435.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 19-15191788-ATCCACGCATGTCCCCCCATTGAGACATCGGTGTCCTGGACAGTCG-A is Pathogenic according to our data. Variant chr19-15191788-ATCCACGCATGTCCCCCCATTGAGACATCGGTGTCCTGGACAGTCG-A is described in ClinVar as Pathogenic. ClinVar VariationId is 9222.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000435.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NOTCH3	NM_000435.3	MANE Select	c.714_758delCGACTGTCCAGGACACCGATGTCTCAATGGGGGGACATGCGTGGA	p.Asp239_Asp253del	disruptive_inframe_deletion	Exon 5 of 33	NP_000426.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NOTCH3	ENST00000263388.7	TSL:1 MANE Select	c.714_758delCGACTGTCCAGGACACCGATGTCTCAATGGGGGGACATGCGTGGA	p.Asp239_Asp253del	disruptive_inframe_deletion	Exon 5 of 33	ENSP00000263388.1
	NOTCH3	ENST00000931534.1		c.714_758delCGACTGTCCAGGACACCGATGTCTCAATGGGGGGACATGCGTGGA	p.Asp239_Asp253del	disruptive_inframe_deletion	Exon 5 of 34	ENSP00000601593.1
	NOTCH3	ENST00000931532.1		c.693_737delCGACTGTCCAGGACACCGATGTCTCAATGGGGGGACATGCGTGGA	p.Asp232_Asp246del	disruptive_inframe_deletion	Exon 5 of 32	ENSP00000601591.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Cerebral arteriopathy, autosomal dominant, with subcortical infarcts and leukoencephalopathy, type 1 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.3
Mutation Taster		=14/186	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs864621965; hg19: chr19-15302599;