chr19-15191788-ATCCACGCATGTCCCCCCATTGAGACATCGGTGTCCTGGACAGTCG-A

Position:

• chr19-15191788-ATCCACGCATGTCCCCCCATTGAGACATCGGTGTCCTGGACAGTCG-A

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PM1 PM2 PM4 PP3 PP5

The NM_000435.3(NOTCH3):​c.714_758delCGACTGTCCAGGACACCGATGTCTCAATGGGGGGACATGCGTGGA​(p.Asp239_Asp253del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 33)
• Consequence: NOTCH3 NM_000435.3 disruptive_inframe_deletion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 9.25

Genes affected

NOTCH3 (HGNC:7883): (notch receptor 3) This gene encodes the third discovered human homologue of the Drosophilia melanogaster type I membrane protein notch. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signalling pathway that plays a key role in neural development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remains to be determined. Mutations in NOTCH3 have been identified as the underlying cause of cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PM1: In a domain EGF-like 6; calcium-binding (size 36) in uniprot entity NOTC3_HUMAN there are 12 pathogenic changes around while only 2 benign (86%) in NM_000435.3
• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000435.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 19-15191788-ATCCACGCATGTCCCCCCATTGAGACATCGGTGTCCTGGACAGTCG-A is Pathogenic according to our data. Variant chr19-15191788-ATCCACGCATGTCCCCCCATTGAGACATCGGTGTCCTGGACAGTCG-A is described in ClinVar as [Pathogenic]. Clinvar id is 9222.Status of the report is no_assertion_criteria_provided, 0 stars. Variant chr19-15191788-ATCCACGCATGTCCCCCCATTGAGACATCGGTGTCCTGGACAGTCG-A is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
NOTCH3	NM_000435.3	c.714_758delCGACTGTCCAGGACACCGATGTCTCAATGGGGGGACATGCGTGGA	p.Asp239_Asp253del	disruptive_inframe_deletion	5/33	ENST00000263388.7	NP_000426.2
NOTCH3	XM_005259924.5	c.714_758delCGACTGTCCAGGACACCGATGTCTCAATGGGGGGACATGCGTGGA	p.Asp239_Asp253del	disruptive_inframe_deletion	5/32		XP_005259981.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
NOTCH3	ENST00000263388.7	c.714_758delCGACTGTCCAGGACACCGATGTCTCAATGGGGGGACATGCGTGGA	p.Asp239_Asp253del	disruptive_inframe_deletion	5/33	1	NM_000435.3	ENSP00000263388.1
NOTCH3	ENST00000601011.1	c.711_755delCGACTGTCCAGGACACCGATGTCTCAATGGGGGGACATGCGTGGA	p.Asp238_Asp252del	disruptive_inframe_deletion	5/23	5		ENSP00000473138.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Cerebral arteriopathy, autosomal dominant, with subcortical infarcts and leukoencephalopathy, type 1 Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

Nov 13, 2001

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs864621965; hg19: chr19-15302599;