NM_000497.4:c.317_344delTGCATCCCCACAGGATGAGCCTGGAGCC
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000497.4(CYP11B1):c.317_344delTGCATCCCCACAGGATGAGCCTGGAGCC(p.Leu106ProfsTer18) variant causes a frameshift change. The variant allele was found at a frequency of 0.0000527 in 1,614,052 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. L106L) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000497.4 frameshift
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000497.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CYP11B1 | MANE Select | c.317_344delTGCATCCCCACAGGATGAGCCTGGAGCC | p.Leu106ProfsTer18 | frameshift | Exon 2 of 9 | NP_000488.3 | |||
| CYP11B1 | c.317_344delTGCATCCCCACAGGATGAGCCTGGAGCC | p.Leu106ProfsTer18 | frameshift | Exon 2 of 8 | NP_001021384.1 | P15538-2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CYP11B1 | TSL:1 MANE Select | c.317_344delTGCATCCCCACAGGATGAGCCTGGAGCC | p.Leu106ProfsTer18 | frameshift | Exon 2 of 9 | ENSP00000292427.5 | P15538-1 | ||
| CYP11B1 | TSL:1 | c.452_479delTGCATCCCCACAGGATGAGCCTGGAGCC | p.Leu151ProfsTer18 | frameshift | Exon 3 of 11 | ENSP00000366903.3 | Q4VAR0 | ||
| CYP11B1 | TSL:1 | c.317_344delTGCATCCCCACAGGATGAGCCTGGAGCC | p.Leu106ProfsTer18 | frameshift | Exon 2 of 8 | ENSP00000428043.1 | P15538-2 |
Frequencies
GnomAD3 genomes AF: 0.0000329 AC: 5AN: 152164Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.00000795 AC: 2AN: 251440 AF XY: 0.00000736 show subpopulations
GnomAD4 exome AF: 0.0000547 AC: 80AN: 1461888Hom.: 0 AF XY: 0.0000536 AC XY: 39AN XY: 727244 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.0000329 AC: 5AN: 152164Hom.: 0 Cov.: 32 AF XY: 0.0000404 AC XY: 3AN XY: 74326 show subpopulations ⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at