rs764418169

Variant names:

• chr8-142879082-GGGCTCCAGGCTCATCCTGTGGGGATGCA-G
• rs764418169
• NM_000497.4:c.317_344delTGCATCCCCACAGGATGAGCCTGGAGCC

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000497.4(CYP11B1):​c.317_344delTGCATCCCCACAGGATGAGCCTGGAGCC​(p.Leu106ProfsTer18) variant causes a frameshift change. The variant allele was found at a frequency of 0.0000527 in 1,614,052 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. L106L) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: 𝑓 0.000033 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000055 (0 hom.)
• Consequence: CYP11B1 NM_000497.4 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:4
• Conservation: PhyloP100: 6.38
• Publications: 0 publications found

Genes affected

CYP11B1 (HGNC:2591): (cytochrome P450 family 11 subfamily B member 1) This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane and is involved in the conversion of progesterone to cortisol in the adrenal cortex. Mutations in this gene cause congenital adrenal hyperplasia due to 11-beta-hydroxylase deficiency. Transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008]

GML (HGNC:4375): (glycosylphosphatidylinositol anchored molecule like) Predicted to be involved in DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest; apoptotic process; and negative regulation of cell population proliferation. Predicted to be extrinsic component of membrane. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 8-142879082-GGGCTCCAGGCTCATCCTGTGGGGATGCA-G is Pathogenic according to our data. Variant chr8-142879082-GGGCTCCAGGCTCATCCTGTGGGGATGCA-G is described in ClinVar as Pathogenic. ClinVar VariationId is 551876.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CYP11B1	NM_000497.4	c.317_344delTGCATCCCCACAGGATGAGCCTGGAGCC	p.Leu106ProfsTer18	frameshift_variant	Exon 2 of 9	ENST00000292427.10	NP_000488.3
CYP11B1	NM_001026213.1	c.317_344delTGCATCCCCACAGGATGAGCCTGGAGCC	p.Leu106ProfsTer18	frameshift_variant	Exon 2 of 8		NP_001021384.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CYP11B1	ENST00000292427.10	c.317_344delTGCATCCCCACAGGATGAGCCTGGAGCC	p.Leu106ProfsTer18	frameshift_variant	Exon 2 of 9	1	NM_000497.4	ENSP00000292427.5

Frequencies

GnomAD3 genomes AF: 0.0000329 AC: 5 AN: 152164 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000735

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00000795 AC: 2 AN: 251440 AF XY: 0.00000736

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000176

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000547 AC: 80 AN: 1461888 Hom.: 0 AF XY: 0.0000536 AC XY: 39 AN XY: 727244

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0000299 AC: 1 AN: 33480

American (AMR) AF: 0.00 AC: 0 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86258

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53416

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.0000692 AC: 77 AN: 1112010

Other (OTH) AF: 0.0000331 AC: 2 AN: 60396

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000329 AC: 5 AN: 152164 Hom.: 0 Cov.: 32 AF XY: 0.0000404 AC XY: 3 AN XY: 74326

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 41438

American (AMR) AF: 0.00 AC: 0 AN: 15274

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5194

South Asian (SAS) AF: 0.00 AC: 0 AN: 4828

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10612

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000735 AC: 5 AN: 68030

Other (OTH) AF: 0.00 AC: 0 AN: 2088

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0.00000000000315292), which strongly suggests a high chance of mosaicism in these individuals.

Alfa AF: 0.0000843 Hom.: 0

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Deficiency of steroid 11-beta-monooxygenase Pathogenic:2

May 10, 2017

Counsyl

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

This submission and the accompanying classification are no longer maintained by the submitter. For more information on current observations and classification, please contact variantquestions@myriad.com. -

Mar 25, 2024

Baylor Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Deficiency of steroid 11-beta-monooxygenase;C3838731:Glucocorticoid-remediable aldosteronism Pathogenic:1

Feb 13, 2024

Fulgent Genetics, Fulgent Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not provided Pathogenic:1

Sep 14, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Leu106Profs*18) in the CYP11B1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in CYP11B1 are known to be pathogenic (PMID: 8506298, 26476331). For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 551876). This premature translational stop signal has been observed in individual(s) with congenital adrenal hyperplasia (PMID: 28228528). This variant is present in population databases (rs764418169, gnomAD 0.002%). -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.4
Mutation Taster		=13/187	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs764418169; hg19: chr8-143960498;