rs764418169
Variant summary
Our verdict is Pathogenic. Variant got 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000497.4(CYP11B1):c.317_344delTGCATCCCCACAGGATGAGCCTGGAGCC(p.Leu106ProfsTer18) variant causes a frameshift change. The variant allele was found at a frequency of 0.0000527 in 1,614,052 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000497.4 frameshift
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 16 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
CYP11B1 | NM_000497.4 | c.317_344delTGCATCCCCACAGGATGAGCCTGGAGCC | p.Leu106ProfsTer18 | frameshift_variant | Exon 2 of 9 | ENST00000292427.10 | NP_000488.3 | |
CYP11B1 | NM_001026213.1 | c.317_344delTGCATCCCCACAGGATGAGCCTGGAGCC | p.Leu106ProfsTer18 | frameshift_variant | Exon 2 of 8 | NP_001021384.1 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.0000329 AC: 5AN: 152164Hom.: 0 Cov.: 32
GnomAD3 exomes AF: 0.00000795 AC: 2AN: 251440Hom.: 0 AF XY: 0.00000736 AC XY: 1AN XY: 135892
GnomAD4 exome AF: 0.0000547 AC: 80AN: 1461888Hom.: 0 AF XY: 0.0000536 AC XY: 39AN XY: 727244
GnomAD4 genome AF: 0.0000329 AC: 5AN: 152164Hom.: 0 Cov.: 32 AF XY: 0.0000404 AC XY: 3AN XY: 74326
ClinVar
Submissions by phenotype
Deficiency of steroid 11-beta-monooxygenase Pathogenic:2
- -
- -
Deficiency of steroid 11-beta-monooxygenase;C3838731:Glucocorticoid-remediable aldosteronism Pathogenic:1
- -
not provided Pathogenic:1
This sequence change creates a premature translational stop signal (p.Leu106Profs*18) in the CYP11B1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in CYP11B1 are known to be pathogenic (PMID: 8506298, 26476331). For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 551876). This premature translational stop signal has been observed in individual(s) with congenital adrenal hyperplasia (PMID: 28228528). This variant is present in population databases (rs764418169, gnomAD 0.002%). -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at