NM_000505.4:c.971_1018+24delAGCCTCAGCCCACGACCCGGACCCCGCCTCAGTCCCAGACCCCGGGAGGTTAGGAAGTGGGGGGGGGAAGGA

Variant names:

• chr5-177404171-CTCCTTCCCCCCCCCACTTCCTAACCTCCCGGGGTCTGGGACTGAGGCGGGGTCCGGGTCGTGGGCTGAGGCT-C
• rs1554097246
• NM_000505.4:c.971_1018+24delAGCCTCAGCCCACGACCCGGACCCCGCCTCAGTCCCAGACCCCGGGAGGTTAGGAAGTGGGGGGGGGAAGGA

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_000505.4(F12):​c.971_1018+24delAGCCTCAGCCCACGACCCGGACCCCGCCTCAGTCCCAGACCCCGGGAGGTTAGGAAGTGGGGGGGGGAAGGA​(p.Lys324_Ala340delinsThr) variant causes a splice donor, disruptive inframe deletion, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000837 in 1,434,486 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency:
  • Genomes: not found (cov: 0)
  • Exomes 𝑓: 0.0000084 (0 hom.)
• Consequence: F12 NM_000505.4 splice_donor, disruptive_inframe_deletion, splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:3
• Conservation: PhyloP100: -0.153
• Publications: 9 publications found

Genes affected

F12 (HGNC:3530): (coagulation factor XII) This gene encodes coagulation factor XII which circulates in blood as a zymogen. This single chain zymogen is converted to a two-chain serine protease with an heavy chain (alpha-factor XIIa) and a light chain. The heavy chain contains two fibronectin-type domains, two epidermal growth factor (EGF)-like domains, a kringle domain and a proline-rich domain, whereas the light chain contains only a catalytic domain. On activation, further cleavages takes place in the heavy chain, resulting in the production of beta-factor XIIa light chain and the alpha-factor XIIa light chain becomes beta-factor XIIa heavy chain. Prekallikrein is cleaved by factor XII to form kallikrein, which then cleaves factor XII first to alpha-factor XIIa and then to beta-factor XIIa. The active factor XIIa participates in the initiation of blood coagulation, fibrinolysis, and the generation of bradykinin and angiotensin. It activates coagulation factors VII and XI. Defects in this gene do not cause any clinical symptoms and the sole effect is that whole-blood clotting time is prolonged. [provided by RefSeq, Jul 2008]

GRK6 (HGNC:4545): (G protein-coupled receptor kinase 6) This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates the activated forms of G protein-coupled receptors thus initiating their deactivation. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
• PP5: Variant 5-177404171-CTCCTTCCCCCCCCCACTTCCTAACCTCCCGGGGTCTGGGACTGAGGCGGGGTCCGGGTCGTGGGCTGAGGCT-C is Pathogenic according to our data. Variant chr5-177404171-CTCCTTCCCCCCCCCACTTCCTAACCTCCCGGGGTCTGGGACTGAGGCGGGGTCCGGGTCGTGGGCTGAGGCT-C is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 441533.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
F12	NM_000505.4	c.971_1018+24delAGCCTCAGCCCACGACCCGGACCCCGCCTCAGTCCCAGACCCCGGGAGGTTAGGAAGTGGGGGGGGGAAGGA	p.Lys324_Ala340delinsThr	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 9 of 14	ENST00000253496.4	NP_000496.2
F12	XM_011534462.3	c.635_682+24delAGCCTCAGCCCACGACCCGGACCCCGCCTCAGTCCCAGACCCCGGGAGGTTAGGAAGTGGGGGGGGGAAGGA	p.Lys212_Ala228delinsThr	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 6 of 11		XP_011532764.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
F12	ENST00000253496.4	c.971_1018+24delAGCCTCAGCCCACGACCCGGACCCCGCCTCAGTCCCAGACCCCGGGAGGTTAGGAAGTGGGGGGGGGAAGGA	p.Lys324_Ala340delinsThr	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 9 of 14	1	NM_000505.4	ENSP00000253496.3

Frequencies

GnomAD3 genomes Cov.: 0

GnomAD2 exomes AF: 0.0000150 AC: 2 AN: 133604 AF XY: 0.0000276

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000432

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000837 AC: 12 AN: 1434486 Hom.: 0 AF XY: 0.0000127 AC XY: 9 AN XY: 711312

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 32936

American (AMR) AF: 0.00 AC: 0 AN: 40266

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25506

East Asian (EAS) AF: 0.00 AC: 0 AN: 38380

South Asian (SAS) AF: 0.00 AC: 0 AN: 83428

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 49900

Middle Eastern (MID) AF: 0.000525 AC: 3 AN: 5718

European-Non Finnish (NFE) AF: 0.00000637 AC: 7 AN: 1099042

Other (OTH) AF: 0.0000337 AC: 2 AN: 59310

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000239077), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 0

Alfa AF: 0.000112 Hom.: 0

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:3

Revision: criteria provided, single submitter

Submissions by phenotype

Hereditary angioedema type 3 Pathogenic:2

-

ISTH-SSC Genomics in Thrombosis and Hemostasis, KU Leuven, Center for Molecular and Vascular Biology

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

-

Nöthen Lab, Institute of Human Genetics, University Hospital Bonn

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

Reported in two families with hereditary angioedema type III, Family I: observed in two affected females and one unaffected male. Family II: observed in two affected females and one unaffected male and one unaffected female (Bork et al. 2011 PMID: 21849258 and Bork et al. 2014 PMID: 25113305) A reduced penetrance for males is well known, it is estimated at <10%. Functional consequences have been demonstrated experimentally (de Maat et al. 2016 PMID: 27130860). -

F12-related disorder Pathogenic:1

Mar 13, 2024

PreventionGenetics, part of Exact Sciences

Significance: Likely pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

The F12 c.971_1018+24del72 variant is predicted to result in an in-frame deletion (p.Lys324_Ala340delinsThr). This variant in the heterozygous condition was reported in 4 affected individuals and 3 unaffected individuals from two unrelated Turkish families with hereditary angioedema and normal C1 inhibitor (Bork et al. 2011. PubMed ID: 21849258; Bork et al. 2014. PubMed ID: 25113305). This variant was also reported in one individual with ACE inhibitor-induced angioedema (Veronez et al 2017. PubMed ID: 28483295). Functional studies suggest that this variant affects protein normal function (de Maat S et al 2016. PubMed ID: 27130860). It is reported in 0.0043% of alleles in individuals of European (Non-Finnish) descent in gnomAD. This variant is interpreted as likely pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.15
Mutation Taster		=149/51	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554097246; hg19: chr5-176831172;