rs1554097246

Variant names:

• chr5-177404171-CTCCTTCCCCCCCCCACTTCCTAACCTCCCGGGGTCTGGGACTGAGGCGGGGTCCGGGTCGTGGGCTGAGGCT-C
• rs1554097246
• NM_000505.4:c.971_1018+24delAGCCTCAGCCCACGACCCGGACCCCGCCTCAGTCCCAGACCCCGGGAGGTTAGGAAGTGGGGGGGGGAAGGA

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_000505.4(F12):​c.971_1018+24delAGCCTCAGCCCACGACCCGGACCCCGCCTCAGTCCCAGACCCCGGGAGGTTAGGAAGTGGGGGGGGGAAGGA​(p.Lys324_Ala340delinsThr) variant causes a splice donor, disruptive inframe deletion, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000837 in 1,434,486 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency:
  • Genomes: not found (cov: 0)
  • Exomes 𝑓: 0.0000084 (0 hom.)
• Consequence: F12 NM_000505.4 splice_donor, disruptive_inframe_deletion, splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:3
• Conservation: PhyloP100: -0.153
• Publications: 9 publications found

Genes affected

F12 (HGNC:3530): (coagulation factor XII) This gene encodes coagulation factor XII which circulates in blood as a zymogen. This single chain zymogen is converted to a two-chain serine protease with an heavy chain (alpha-factor XIIa) and a light chain. The heavy chain contains two fibronectin-type domains, two epidermal growth factor (EGF)-like domains, a kringle domain and a proline-rich domain, whereas the light chain contains only a catalytic domain. On activation, further cleavages takes place in the heavy chain, resulting in the production of beta-factor XIIa light chain and the alpha-factor XIIa light chain becomes beta-factor XIIa heavy chain. Prekallikrein is cleaved by factor XII to form kallikrein, which then cleaves factor XII first to alpha-factor XIIa and then to beta-factor XIIa. The active factor XIIa participates in the initiation of blood coagulation, fibrinolysis, and the generation of bradykinin and angiotensin. It activates coagulation factors VII and XI. Defects in this gene do not cause any clinical symptoms and the sole effect is that whole-blood clotting time is prolonged. [provided by RefSeq, Jul 2008]

GRK6 (HGNC:4545): (G protein-coupled receptor kinase 6) This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates the activated forms of G protein-coupled receptors thus initiating their deactivation. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
• PP5: Variant 5-177404171-CTCCTTCCCCCCCCCACTTCCTAACCTCCCGGGGTCTGGGACTGAGGCGGGGTCCGGGTCGTGGGCTGAGGCT-C is Pathogenic according to our data. Variant chr5-177404171-CTCCTTCCCCCCCCCACTTCCTAACCTCCCGGGGTCTGGGACTGAGGCGGGGTCCGGGTCGTGGGCTGAGGCT-C is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 441533.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000505.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	F12	NM_000505.4	MANE Select	c.971_1018+24delAGCCTCAGCCCACGACCCGGACCCCGCCTCAGTCCCAGACCCCGGGAGGTTAGGAAGTGGGGGGGGGAAGGA	p.Lys324_Ala340delinsThr	splice_donor disruptive_inframe_deletion splice_region intron	Exon 9 of 14	NP_000496.2	P00748

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	F12	ENST00000253496.4	TSL:1 MANE Select	c.971_1018+24delAGCCTCAGCCCACGACCCGGACCCCGCCTCAGTCCCAGACCCCGGGAGGTTAGGAAGTGGGGGGGGGAAGGA	p.Lys324_Ala340delinsThr	splice_donor disruptive_inframe_deletion splice_region intron	Exon 9 of 14	ENSP00000253496.3	P00748
	F12	ENST00000898128.1		c.1046_1093+24delAGCCTCAGCCCACGACCCGGACCCCGCCTCAGTCCCAGACCCCGGGAGGTTAGGAAGTGGGGGGGGGAAGGA	p.Lys349_Ala365delinsThr	splice_donor disruptive_inframe_deletion splice_region intron	Exon 10 of 15	ENSP00000568187.1
	F12	ENST00000898127.1		c.959_1006+24delAGCCTCAGCCCACGACCCGGACCCCGCCTCAGTCCCAGACCCCGGGAGGTTAGGAAGTGGGGGGGGGAAGGA	p.Lys320_Ala336delinsThr	splice_donor disruptive_inframe_deletion splice_region intron	Exon 8 of 13	ENSP00000568186.1

Frequencies

GnomAD3 genomes Cov.: 0

GnomAD2 exomes AF: 0.0000150 AC: 2 AN: 133604 AF XY: 0.0000276

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000432

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000837 AC: 12 AN: 1434486 Hom.: 0 AF XY: 0.0000127 AC XY: 9 AN XY: 711312

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 32936

American (AMR) AF: 0.00 AC: 0 AN: 40266

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25506

East Asian (EAS) AF: 0.00 AC: 0 AN: 38380

South Asian (SAS) AF: 0.00 AC: 0 AN: 83428

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 49900

Middle Eastern (MID) AF: 0.000525 AC: 3 AN: 5718

European-Non Finnish (NFE) AF: 0.00000637 AC: 7 AN: 1099042

Other (OTH) AF: 0.0000337 AC: 2 AN: 59310

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000239077), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 0

Alfa AF: 0.000112 Hom.: 0

ClinVar

ClinVar submissions

Significance: Likely pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
2	-	-	Hereditary angioedema type 3 (2)
1	-	-	F12-related disorder (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.15
Mutation Taster		=149/51	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554097246; hg19: chr5-176831172;