NM_000543.5:c.120_143delGCTGGCGCTGGCGCTGGCGCTGGC
Variant summary
Our verdict is Uncertain significance. The variant received 1 ACMG points: 2P and 1B. PM1BP3
The NM_000543.5(SMPD1):c.120_143delGCTGGCGCTGGCGCTGGCGCTGGC(p.Leu41_Ala48del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000326 in 1,594,986 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. A40A) has been classified as Likely benign.
Frequency
Consequence
NM_000543.5 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- acid sphingomyelinase deficiencyInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- Niemann-Pick diseaseInheritance: AR Classification: DEFINITIVE Submitted by: Myriad Women’s Health
- Niemann-Pick disease type AInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet, G2P
- Niemann-Pick disease type BInheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 1 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| SMPD1 | NM_000543.5 | c.120_143delGCTGGCGCTGGCGCTGGCGCTGGC | p.Leu41_Ala48del | disruptive_inframe_deletion | Exon 1 of 6 | ENST00000342245.9 | NP_000534.3 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| SMPD1 | ENST00000342245.9 | c.120_143delGCTGGCGCTGGCGCTGGCGCTGGC | p.Leu41_Ala48del | disruptive_inframe_deletion | Exon 1 of 6 | 1 | NM_000543.5 | ENSP00000340409.4 |
Frequencies
GnomAD3 genomes AF: 0.0000475 AC: 7AN: 147228Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome AF: 0.0000311 AC: 45AN: 1447758Hom.: 0 AF XY: 0.0000347 AC XY: 25AN XY: 720014 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000475 AC: 7AN: 147228Hom.: 0 Cov.: 0 AF XY: 0.0000278 AC XY: 2AN XY: 71866 show subpopulations
Age Distribution
ClinVar
Submissions by phenotype
Niemann-Pick disease, type A;C0268243:Niemann-Pick disease, type B Uncertain:1
This variant, c.120_143del, results in the deletion of 8 amino acid(s) of the SMPD1 protein (p.Ala42_Leu49del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals affected with SMPD1-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at