rs3838786

Positions:

• chr11-6390705-TGCTGGCGCTGGCGCTGGCGCTGGC-T
• chr11-6390705-TGCTGGCGCTGGCGCTGGCGCTGGC-TGCTGGC
• chr11-6390705-TGCTGGCGCTGGCGCTGGCGCTGGC-TGCTGGCGCTGGC
• chr11-6390705-TGCTGGCGCTGGCGCTGGCGCTGGC-TGCTGGCGCTGGCGCTGGC
• chr11-6390705-TGCTGGCGCTGGCGCTGGCGCTGGC-TGCTGGCGCTGGCGCTGGCGCTGGCGCTGGC
• chr11-6390705-TGCTGGCGCTGGCGCTGGCGCTGGC-TGCTGGCGCTGGCGCTGGCGCTGGCGCTGGCGCTGGC
• chr11-6390705-TGCTGGCGCTGGCGCTGGCGCTGGC-TGCTGGCGCTGGCGCTGGCGCTGGCGCTGGCGCTGGCGCTGGC
• chr11-6390705-TGCTGGCGCTGGCGCTGGCGCTGGC-TGCTGGCGCTGGCGCTGGCGCTGGCGCTGGCGCTGGCGCTGGCGCTGGCGCTGGC

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_000543.5(SMPD1):​c.120_143delGCTGGCGCTGGCGCTGGCGCTGGC​(p.Leu41_Ala48del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000326 in 1,594,986 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: 𝑓 0.000048 (0 hom., cov: 0)
  • Exomes 𝑓: 0.000031 (0 hom.)
• Consequence: SMPD1 NM_000543.5 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.65

Genes affected

SMPD1 (HGNC:11120): (sphingomyelin phosphodiesterase 1) The protein encoded by this gene is a lysosomal acid sphingomyelinase that converts sphingomyelin to ceramide. The encoded protein also has phospholipase C activity. Defects in this gene are a cause of Niemann-Pick disease type A (NPA) and Niemann-Pick disease type B (NPB). Multiple transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2010]

SMPD1 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
SMPD1	NM_000543.5	c.120_143delGCTGGCGCTGGCGCTGGCGCTGGC	p.Leu41_Ala48del	disruptive_inframe_deletion	1/6	ENST00000342245.9	NP_000534.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
SMPD1	ENST00000342245.9	c.120_143delGCTGGCGCTGGCGCTGGCGCTGGC	p.Leu41_Ala48del	disruptive_inframe_deletion	1/6	1	NM_000543.5	ENSP00000340409.4

Frequencies

GnomAD3 genomes AF: 0.0000475 AC: 7 AN: 147228 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000106

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000311 AC: 45 AN: 1447758 Hom.: 0 AF XY: 0.0000347 AC XY: 25 AN XY: 720014

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.0000775

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000363

Gnomad4 OTH exome AF: 0.0000335

GnomAD4 genome AF: 0.0000475 AC: 7 AN: 147228 Hom.: 0 Cov.: 0 AF XY: 0.0000278 AC XY: 2 AN XY: 71866

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000106

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Niemann-Pick disease, type A;C0268243:Niemann-Pick disease, type B Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Sep 01, 2021

This variant, c.120_143del, results in the deletion of 8 amino acid(s) of the SMPD1 protein (p.Ala42_Leu49del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals affected with SMPD1-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs3838786; hg19: chr11-6411935;