NM_000551.4:c.-50_-28delACCCGCGGATCCCGCGGCGTCCG
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_000551.4(VHL):c.-50_-28delACCCGCGGATCCCGCGGCGTCCG variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000581 in 1,375,788 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).
Frequency
Consequence
NM_000551.4 5_prime_UTR
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
VHL | NM_000551.4 | c.-50_-28delACCCGCGGATCCCGCGGCGTCCG | 5_prime_UTR_variant | Exon 1 of 3 | ENST00000256474.3 | NP_000542.1 | ||
VHL | NM_001354723.2 | c.-50_-28delACCCGCGGATCCCGCGGCGTCCG | 5_prime_UTR_variant | Exon 1 of 3 | NP_001341652.1 | |||
VHL | NM_198156.3 | c.-50_-28delACCCGCGGATCCCGCGGCGTCCG | 5_prime_UTR_variant | Exon 1 of 2 | NP_937799.1 | |||
VHL | NR_176335.1 | n.21_43delACCCGCGGATCCCGCGGCGTCCG | non_coding_transcript_exon_variant | Exon 1 of 4 |
Ensembl
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome AF: 0.00000581 AC: 8AN: 1375788Hom.: 0 AF XY: 0.00000737 AC XY: 5AN XY: 678204 show subpopulations
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Von Hippel-Lindau syndrome Uncertain:1
This variant causes a 23-nucleotide deletion in the 5' untranslated region of the VHL gene. To our knowledge, functional studies have not been reported for this variant. This variant has not been reported in individuals affected with VHL-related disorders in the literature. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance. -
Von Hippel-Lindau syndrome;C1837915:Chuvash polycythemia Uncertain:1
This variant occurs in a non-coding region of the VHL gene. It does not change the encoded amino acid sequence of the VHL protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with VHL-related conditions. ClinVar contains an entry for this variant (Variation ID: 3069676). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at