chr3-10141790-CGCGTCCGACCCGCGGATCCCGCG-C

Position:

• chr3-10141790-CGCGTCCGACCCGCGGATCCCGCG-C

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 0P and 0B.

The NM_000551.4(VHL):​c.-50_-28delACCCGCGGATCCCGCGGCGTCCG variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000581 in 1,375,788 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000058 (0 hom.)
• Consequence: VHL NM_000551.4 5_prime_UTR
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.73

Genes affected

VHL (HGNC:12687): (von Hippel-Lindau tumor suppressor) This gene encodes a component of a ubiquitination complex. The encoded protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. In addition to oxygen-related gene expression, this protein plays a role in many other cellular processes including cilia formation, cytokine signaling, regulation of senescence, and formation of the extracellular matrix. Variants of this gene are associated with von Hippel-Lindau syndrome, pheochromocytoma, erythrocytosis, renal cell carcinoma, and cerebellar hemangioblastoma. [provided by RefSeq, Jun 2022]

VHL (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
VHL	NM_000551.4	c.-50_-28delACCCGCGGATCCCGCGGCGTCCG		5_prime_UTR_variant	1/3	ENST00000256474.3	NP_000542.1
VHL	NM_001354723.2	c.-50_-28delACCCGCGGATCCCGCGGCGTCCG		5_prime_UTR_variant	1/3		NP_001341652.1
VHL	NM_198156.3	c.-50_-28delACCCGCGGATCCCGCGGCGTCCG		5_prime_UTR_variant	1/2		NP_937799.1
VHL	NR_176335.1	n.21_43delACCCGCGGATCCCGCGGCGTCCG		non_coding_transcript_exon_variant	1/4

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
VHL	ENST00000256474	c.-50_-28delACCCGCGGATCCCGCGGCGTCCG		5_prime_UTR_variant	1/3	1	NM_000551.4	ENSP00000256474.3

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.00000581 AC: 8 AN: 1375788 Hom.: 0 AF XY: 0.00000737 AC XY: 5 AN XY: 678204

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.0000128

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000563

Gnomad4 OTH exome AF: 0.0000176

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Von Hippel-Lindau syndrome Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

All of Us Research Program, National Institutes of Health

Feb 24, 2023

This variant causes a 23-nucleotide deletion in the 5' untranslated region of the VHL gene. To our knowledge, functional studies have not been reported for this variant. This variant has not been reported in individuals affected with VHL-related disorders in the literature. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr3-10183474;