NM_000558.5:c.157_180delTCTGCCCAGGTTAAGGGCCACGGC
Variant summary
Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM1PM4
The NM_000558.5(HBA1):c.157_180delTCTGCCCAGGTTAAGGGCCACGGC(p.Ser53_Gly60del) variant causes a conservative inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as other (no stars).
Frequency
Consequence
NM_000558.5 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- HBA1-related alpha thalassemia spectrumInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- alpha thalassemia spectrumInheritance: SD, AR Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
- erythrocytosis, familial, 7Inheritance: AD Classification: STRONG, MODERATE Submitted by: Genomics England PanelApp, ClinGen
- unstable hemoglobin diseaseInheritance: AD Classification: MODERATE Submitted by: ClinGen
- hemoglobin M diseaseInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Hb Bart's hydrops fetalisInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- hemoglobin H diseaseInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- methemoglobinemia, alpha typeInheritance: AD Classification: LIMITED Submitted by: ClinGen
- Heinz body anemiaInheritance: AR Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000558.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| HBA1 | NM_000558.5 | MANE Select | c.157_180delTCTGCCCAGGTTAAGGGCCACGGC | p.Ser53_Gly60del | conservative_inframe_deletion | Exon 2 of 3 | NP_000549.1 | P69905 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| HBA1 | ENST00000320868.9 | TSL:1 MANE Select | c.157_180delTCTGCCCAGGTTAAGGGCCACGGC | p.Ser53_Gly60del | conservative_inframe_deletion | Exon 2 of 3 | ENSP00000322421.5 | P69905 | |
| HBA1 | ENST00000472694.1 | TSL:1 | n.293_316delTCTGCCCAGGTTAAGGGCCACGGC | non_coding_transcript_exon | Exon 1 of 2 | ||||
| HBA1 | ENST00000487791.1 | TSL:1 | n.126_149delTCTGCCCAGGTTAAGGGCCACGGC | non_coding_transcript_exon | Exon 2 of 2 |
Frequencies
GnomAD3 genomes Cov.: 30
GnomAD4 genome Cov.: 30
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at