NM_000603.5:c.582+317_582+343dupAGGGGTGAGGAAGTCTAGACCTGCTGC

Variant names:

• chr7-150997169-A-AGAAGTCTAGACCTGCTGCAGGGGTGAG
• rs61722009
• NM_000603.5:c.582+317_582+343dupAGGGGTGAGGAAGTCTAGACCTGCTGC

Variant summary

Our verdict is Likely benign. The variant received -4 ACMG points: 0P and 4B. BS2

The NM_000603.5(NOS3):​c.582+317_582+343dupAGGGGTGAGGAAGTCTAGACCTGCTGC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000431 in 148,598 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: 𝑓 0.00043 (0 hom., cov: 30)
• Consequence: NOS3 NM_000603.5 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.435
• Publications: 34 publications found

Genes affected

NOS3 (HGNC:7876): (nitric oxide synthase 3) Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. Nitric oxide is synthesized from L-arginine by nitric oxide synthases. Variations in this gene are associated with susceptibility to coronary spasm. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Oct 2016]

ACMG classification

Our verdict: Likely_benign. The variant received -4 ACMG points.

• BS2: High AC in GnomAd4 at 64 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000603.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NOS3	NM_000603.5	MANE Select	c.582+317_582+343dupAGGGGTGAGGAAGTCTAGACCTGCTGC		intron	N/A	NP_000594.2
	NOS3	NM_001160111.1		c.582+317_582+343dupAGGGGTGAGGAAGTCTAGACCTGCTGC		intron	N/A	NP_001153583.1
	NOS3	NM_001160110.1		c.582+317_582+343dupAGGGGTGAGGAAGTCTAGACCTGCTGC		intron	N/A	NP_001153582.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NOS3	ENST00000297494.8	TSL:1 MANE Select	c.582+244_582+245insGAAGTCTAGACCTGCTGCAGGGGTGAG		intron	N/A	ENSP00000297494.3
	NOS3	ENST00000484524.5	TSL:1	c.582+244_582+245insGAAGTCTAGACCTGCTGCAGGGGTGAG		intron	N/A	ENSP00000420215.1
	NOS3	ENST00000467517.1	TSL:1	c.582+244_582+245insGAAGTCTAGACCTGCTGCAGGGGTGAG		intron	N/A	ENSP00000420551.1

Frequencies

GnomAD3 genomes AF: 0.000424 AC: 63 AN: 148482 Hom.: 0 Cov.: 30

Gnomad AFR AF: 0.00151

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000199

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000148

Gnomad OTH AF: 0.00

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.000431 AC: 64 AN: 148598 Hom.: 0 Cov.: 30 AF XY: 0.000372 AC XY: 27 AN XY: 72570

African (AFR) AF: 0.00153 AC: 60 AN: 39106

American (AMR) AF: 0.000198 AC: 3 AN: 15114

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3448

East Asian (EAS) AF: 0.00 AC: 0 AN: 5116

South Asian (SAS) AF: 0.00 AC: 0 AN: 4732

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10376

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 290

European-Non Finnish (NFE) AF: 0.0000148 AC: 1 AN: 67436

Other (OTH) AF: 0.00 AC: 0 AN: 2074

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.43

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs61722009; hg19: chr7-150694257;