rs61722009

Variant names:

• chr7-150997169-AGAAGTCTAGACCTGCTGCAGGGGTGAG-A
• rs61722009
• NM_000603.5:c.582+317_582+343delAGGGGTGAGGAAGTCTAGACCTGCTGC

Your query was ambiguous. Multiple possible variants found:

• chr7-150997169-AGAAGTCTAGACCTGCTGCAGGGGTGAG-A
• chr7-150997169-AGAAGTCTAGACCTGCTGCAGGGGTGAG-AGAAGTCTAGACCTGCTGCAGGGGTGAGGAAGTCTAGACCTGCTGCAGGGGTGAG

Variant summary

Our verdict is Benign. Variant got -8 ACMG points: 0P and 8B. BA1

The NM_000603.5(NOS3):​c.582+317_582+343delAGGGGTGAGGAAGTCTAGACCTGCTGC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0324 in 148,492 control chromosomes in the GnomAD database, including 554 homozygotes. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: 𝑓 0.032 (554 hom., cov: 30)
• Consequence: NOS3 NM_000603.5 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.435

Genes affected

NOS3 (HGNC:7876): (nitric oxide synthase 3) Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. Nitric oxide is synthesized from L-arginine by nitric oxide synthases. Variations in this gene are associated with susceptibility to coronary spasm. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Oct 2016]

ACMG classification

Verdict is Benign. Variant got -8 ACMG points.

• BA1: GnomAd4 highest subpopulation (AFR) allele frequency at 95% confidence interval = 0.0521 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
NOS3	NM_000603.5	c.582+317_582+343delAGGGGTGAGGAAGTCTAGACCTGCTGC		intron_variant	Intron 5 of 26	ENST00000297494.8	NP_000594.2
NOS3	NM_001160111.1	c.582+317_582+343delAGGGGTGAGGAAGTCTAGACCTGCTGC		intron_variant	Intron 4 of 13		NP_001153583.1
NOS3	NM_001160110.1	c.582+317_582+343delAGGGGTGAGGAAGTCTAGACCTGCTGC		intron_variant	Intron 4 of 13		NP_001153582.1
NOS3	NM_001160109.2	c.582+317_582+343delAGGGGTGAGGAAGTCTAGACCTGCTGC		intron_variant	Intron 4 of 13		NP_001153581.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
NOS3	ENST00000297494.8	c.582+245_582+271delGAAGTCTAGACCTGCTGCAGGGGTGAG		intron_variant	Intron 5 of 26	1	NM_000603.5	ENSP00000297494.3
NOS3	ENST00000484524.5	c.582+245_582+271delGAAGTCTAGACCTGCTGCAGGGGTGAG		intron_variant	Intron 4 of 13	1		ENSP00000420215.1
NOS3	ENST00000467517.1	c.582+245_582+271delGAAGTCTAGACCTGCTGCAGGGGTGAG		intron_variant	Intron 4 of 13	1		ENSP00000420551.1
NOS3	ENST00000461406.5	c.-36-1187_-36-1161delGAAGTCTAGACCTGCTGCAGGGGTGAG		intron_variant	Intron 2 of 23	2		ENSP00000417143.1

Frequencies

GnomAD3 genomes AF: 0.0324 AC: 4807 AN: 148376 Hom.: 552 Cov.: 30

Gnomad AFR AF: 0.0540

Gnomad AMI AF: 0.0188

Gnomad AMR AF: 0.0205

Gnomad ASJ AF: 0.0270

Gnomad EAS AF: 0.0158

Gnomad SAS AF: 0.0241

Gnomad FIN AF: 0.0336

Gnomad MID AF: 0.0321

Gnomad NFE AF: 0.0250

Gnomad OTH AF: 0.0239

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.0324 AC: 4813 AN: 148492 Hom.: 554 Cov.: 30 AF XY: 0.0319 AC XY: 2315 AN XY: 72510

Gnomad4 AFR AF: 0.0541

Gnomad4 AMR AF: 0.0205

Gnomad4 ASJ AF: 0.0270

Gnomad4 EAS AF: 0.0158

Gnomad4 SAS AF: 0.0237

Gnomad4 FIN AF: 0.0336

Gnomad4 NFE AF: 0.0250

Gnomad4 OTH AF: 0.0236

Alfa AF: 0.00601 Hom.: 19

Asia WGS AF: 0.0180 AC: 64 AN: 3478

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs61722009; hg19: chr7-150694257;