rs61722009

Variant names:

• chr7-150997169-AGAAGTCTAGACCTGCTGCAGGGGTGAG-A
• rs61722009
• NM_000603.5:c.582+317_582+343delAGGGGTGAGGAAGTCTAGACCTGCTGC

Your query was ambiguous. Multiple possible variants found:

• chr7-150997169-AGAAGTCTAGACCTGCTGCAGGGGTGAG-A
• chr7-150997169-AGAAGTCTAGACCTGCTGCAGGGGTGAG-AGAAGTCTAGACCTGCTGCAGGGGTGAGGAAGTCTAGACCTGCTGCAGGGGTGAG

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BA1

The NM_000603.5(NOS3):​c.582+317_582+343delAGGGGTGAGGAAGTCTAGACCTGCTGC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0324 in 148,492 control chromosomes in the GnomAD database, including 554 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: 𝑓 0.032 (554 hom., cov: 30)
• Consequence: NOS3 NM_000603.5 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.435
• Publications: 34 publications found

Genes affected

NOS3 (HGNC:7876): (nitric oxide synthase 3) Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. Nitric oxide is synthesized from L-arginine by nitric oxide synthases. Variations in this gene are associated with susceptibility to coronary spasm. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Oct 2016]

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• BA1: GnomAd4 highest subpopulation (AFR) allele frequency at 95% confidence interval = 0.0521 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
NOS3	NM_000603.5	c.582+317_582+343delAGGGGTGAGGAAGTCTAGACCTGCTGC		intron_variant	Intron 5 of 26	ENST00000297494.8	NP_000594.2
NOS3	NM_001160111.1	c.582+317_582+343delAGGGGTGAGGAAGTCTAGACCTGCTGC		intron_variant	Intron 4 of 13		NP_001153583.1
NOS3	NM_001160110.1	c.582+317_582+343delAGGGGTGAGGAAGTCTAGACCTGCTGC		intron_variant	Intron 4 of 13		NP_001153582.1
NOS3	NM_001160109.2	c.582+317_582+343delAGGGGTGAGGAAGTCTAGACCTGCTGC		intron_variant	Intron 4 of 13		NP_001153581.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
NOS3	ENST00000297494.8	c.582+245_582+271delGAAGTCTAGACCTGCTGCAGGGGTGAG		intron_variant	Intron 5 of 26	1	NM_000603.5	ENSP00000297494.3
NOS3	ENST00000484524.5	c.582+245_582+271delGAAGTCTAGACCTGCTGCAGGGGTGAG		intron_variant	Intron 4 of 13	1		ENSP00000420215.1
NOS3	ENST00000467517.1	c.582+245_582+271delGAAGTCTAGACCTGCTGCAGGGGTGAG		intron_variant	Intron 4 of 13	1		ENSP00000420551.1
NOS3	ENST00000461406.5	c.-36-1187_-36-1161delGAAGTCTAGACCTGCTGCAGGGGTGAG		intron_variant	Intron 2 of 23	2		ENSP00000417143.1

Frequencies

GnomAD3 genomes AF: 0.0324 AC: 4807 AN: 148376 Hom.: 552 Cov.: 30

Gnomad AFR AF: 0.0540

Gnomad AMI AF: 0.0188

Gnomad AMR AF: 0.0205

Gnomad ASJ AF: 0.0270

Gnomad EAS AF: 0.0158

Gnomad SAS AF: 0.0241

Gnomad FIN AF: 0.0336

Gnomad MID AF: 0.0321

Gnomad NFE AF: 0.0250

Gnomad OTH AF: 0.0239

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.0324 AC: 4813 AN: 148492 Hom.: 554 Cov.: 30 AF XY: 0.0319 AC XY: 2315 AN XY: 72510

African (AFR) AF: 0.0541 AC: 2112 AN: 39060

American (AMR) AF: 0.0205 AC: 309 AN: 15104

Ashkenazi Jewish (ASJ) AF: 0.0270 AC: 93 AN: 3444

East Asian (EAS) AF: 0.0158 AC: 81 AN: 5114

South Asian (SAS) AF: 0.0237 AC: 112 AN: 4730

European-Finnish (FIN) AF: 0.0336 AC: 349 AN: 10372

Middle Eastern (MID) AF: 0.0310 AC: 9 AN: 290

European-Non Finnish (NFE) AF: 0.0250 AC: 1682 AN: 67398

Other (OTH) AF: 0.0236 AC: 49 AN: 2074

Alfa AF: 0.00601 Hom.: 19

Asia WGS AF: 0.0180 AC: 64 AN: 3478

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.43
Mutation Taster		=100/0	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs61722009; hg19: chr7-150694257;