NM_000642.3:c.959-72_965dupTTAGAAAATAGTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTTTTAGAAAATAG

Variant names:

• chr1-99874614-A-ATTAGAAAATAGTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTTTTAGAAAATAG
• rs1553185268
• NM_000642.3:c.959-72_965dupTTAGAAAATAGTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTTTTAGAAAATAG

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_000642.3(AGL):​c.959-72_965dupTTAGAAAATAGTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTTTTAGAAAATAG​(p.Arg322fs) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. R322R) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: AGL NM_000642.3 frameshift, stop_gained
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: -0.361
• Publications: 0 publications found

Genes affected

AGL (HGNC:321): (amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase) This gene encodes the glycogen debrancher enzyme which is involved in glycogen degradation. This enzyme has two independent catalytic activities which occur at different sites on the protein: a 4-alpha-glucotransferase activity and a amylo-1,6-glucosidase activity. Mutations in this gene are associated with glycogen storage disease although a wide range of enzymatic and clinical variability occurs which may be due to tissue-specific alternative splicing. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

AGL Gene-Disease associations (from GenCC):

• glycogen storage disease III

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, ClinGen, Orphanet, Labcorp Genetics (formerly Invitae), G2P, Genomics England PanelApp, Laboratory for Molecular Medicine, Myriad Women’s Health

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000642.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	AGL	NM_000642.3	MANE Select	c.959-72_965dupTTAGAAAATAGTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTTTTAGAAAATAG	p.Arg322fs	frameshift stop_gained	Exon 8 of 34	NP_000633.2	P35573-1
	AGL	NM_000028.3		c.959-72_965dupTTAGAAAATAGTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTTTTAGAAAATAG	p.Arg322fs	frameshift stop_gained	Exon 8 of 34	NP_000019.2	P35573-1
	AGL	NM_000643.3		c.959-72_965dupTTAGAAAATAGTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTTTTAGAAAATAG	p.Arg322fs	frameshift stop_gained	Exon 8 of 34	NP_000634.2	A0A0S2A4E4

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	AGL	ENST00000361915.8	TSL:1 MANE Select	c.959-72_965dupTTAGAAAATAGTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTTTTAGAAAATAG	p.Arg322fs	frameshift stop_gained	Exon 8 of 34	ENSP00000355106.3	P35573-1
	AGL	ENST00000294724.8	TSL:1	c.959-72_965dupTTAGAAAATAGTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTTTTAGAAAATAG	p.Arg322fs	frameshift stop_gained	Exon 8 of 34	ENSP00000294724.4	P35573-1
	AGL	ENST00000370163.7	TSL:1	c.959-72_965dupTTAGAAAATAGTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTTTTAGAAAATAG	p.Arg322fs	frameshift stop_gained	Exon 8 of 34	ENSP00000359182.3	P35573-1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 19

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Glycogen storage disease type III (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.36

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553185268; hg19: chr1-100340170;