rs1553185268
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_000642.3(AGL):c.959-61_965dupTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTTTTAGAAAATAG(p.Arg322fs) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. R322R) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000642.3 frameshift, stop_gained
Scores
Clinical Significance
Conservation
Publications
- glycogen storage disease IIIInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Laboratory for Molecular Medicine, ClinGen, Myriad Women's Health, Ambry Genetics, Genomics England PanelApp, Orphanet, G2P, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000642.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| AGL | MANE Select | c.959-61_965dupTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTTTTAGAAAATAG | p.Arg322fs | frameshift stop_gained | Exon 8 of 34 | NP_000633.2 | P35573-1 | ||
| AGL | c.959-61_965dupTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTTTTAGAAAATAG | p.Arg322fs | frameshift stop_gained | Exon 8 of 34 | NP_000019.2 | P35573-1 | |||
| AGL | c.959-61_965dupTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTTTTAGAAAATAG | p.Arg322fs | frameshift stop_gained | Exon 8 of 34 | NP_000634.2 | A0A0S2A4E4 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| AGL | TSL:1 MANE Select | c.959-61_965dupTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTTTTAGAAAATAG | p.Arg322fs | frameshift stop_gained | Exon 8 of 34 | ENSP00000355106.3 | P35573-1 | ||
| AGL | TSL:1 | c.959-61_965dupTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTTTTAGAAAATAG | p.Arg322fs | frameshift stop_gained | Exon 8 of 34 | ENSP00000294724.4 | P35573-1 | ||
| AGL | TSL:1 | c.959-61_965dupTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTTTTAGAAAATAG | p.Arg322fs | frameshift stop_gained | Exon 8 of 34 | ENSP00000359182.3 | P35573-1 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome Cov.: 19
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.