NM_000797.4:c.64_87delGCATCTGCGGGGGCATCTGCGGGG

Variant names:

• chr11-637361-CGCGGGGGCATCTGCGGGGGCATCT-C
• rs572586776
• NM_000797.4:c.64_87delGCATCTGCGGGGGCATCTGCGGGG

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_000797.4(DRD4):​c.64_87delGCATCTGCGGGGGCATCTGCGGGG​(p.Ala22_Gly29del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 31)
• Consequence: DRD4 NM_000797.4 conservative_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.873
• Publications: 4 publications found

Genes affected

DRD4 (HGNC:3025): (dopamine receptor D4) This gene encodes the D4 subtype of the dopamine receptor. The D4 subtype is a G-protein coupled receptor which inhibits adenylyl cyclase. It is a target for drugs which treat schizophrenia and Parkinson disease. Mutations in this gene have been associated with various behavioral phenotypes, including autonomic nervous system dysfunction, attention deficit/hyperactivity disorder, and the personality trait of novelty seeking. This gene contains a polymorphic number (2-10 copies) of tandem 48 nt repeats; the sequence shown contains four repeats. [provided by RefSeq, Jul 2008]

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_000797.4

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000797.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DRD4	NM_000797.4	MANE Select	c.64_87delGCATCTGCGGGGGCATCTGCGGGG	p.Ala22_Gly29del	conservative_inframe_deletion	Exon 1 of 4	NP_000788.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DRD4	ENST00000176183.6	TSL:1 MANE Select	c.64_87delGCATCTGCGGGGGCATCTGCGGGG	p.Ala22_Gly29del	conservative_inframe_deletion	Exon 1 of 4	ENSP00000176183.5	P21917

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

Alfa AF: 0.00 Hom.: 6

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.87

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs572586776; hg19: chr11-637361;