chr11-637361-CGCGGGGGCATCTGCGGGGGCATCT-C

Variant names:

• chr11-637361-CGCGGGGGCATCTGCGGGGGCATCT-C
• rs572586776
• NM_000797.4:c.64_87delGCATCTGCGGGGGCATCTGCGGGG

Variant summary

Our verdict is Uncertain significance. Variant got 1 ACMG points: 2P and 1B. PM2 BP3

The NM_000797.4(DRD4):​c.64_87delGCATCTGCGGGGGCATCTGCGGGG​(p.Ala22_Gly29del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 31)
• Consequence: DRD4 NM_000797.4 conservative_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.873

Genes affected

DRD4 (HGNC:3025): (dopamine receptor D4) This gene encodes the D4 subtype of the dopamine receptor. The D4 subtype is a G-protein coupled receptor which inhibits adenylyl cyclase. It is a target for drugs which treat schizophrenia and Parkinson disease. Mutations in this gene have been associated with various behavioral phenotypes, including autonomic nervous system dysfunction, attention deficit/hyperactivity disorder, and the personality trait of novelty seeking. This gene contains a polymorphic number (2-10 copies) of tandem 48 nt repeats; the sequence shown contains four repeats. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 1 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• BP3: Nonframeshift variant in repetitive region in NM_000797.4

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
DRD4	NM_000797.4	c.64_87delGCATCTGCGGGGGCATCTGCGGGG	p.Ala22_Gly29del	conservative_inframe_deletion	Exon 1 of 4	ENST00000176183.6	NP_000788.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
DRD4	ENST00000176183.6	c.64_87delGCATCTGCGGGGGCATCTGCGGGG	p.Ala22_Gly29del	conservative_inframe_deletion	Exon 1 of 4	1	NM_000797.4	ENSP00000176183.5

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs572586776; hg19: chr11-637361;