NM_001013694.3:c.129_149delGAGAGAGGCGGCGCCCCGGGG

Variant names:

• chr22-26483980-GGAGGCGGCGCCCCGGGGGAGA-G
• rs66831137
• NM_001013694.3:c.129_149delGAGAGAGGCGGCGCCCCGGGG

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 2P and 10B. PM4 BP6_Moderate BA1

The NM_001013694.3(SRRD):​c.129_149delGAGAGAGGCGGCGCCCCGGGG​(p.Arg44_Gly50del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.872 in 1,332,650 control chromosomes in the GnomAD database, including 520,703 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.83 (51022 hom., cov: 0)
  • Exomes 𝑓: 0.88 (469681 hom.)
• Consequence: SRRD NM_001013694.3 disruptive_inframe_deletion
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.735
• Publications: 4 publications found

Genes affected

SRRD (HGNC:33910): (SRR1 domain containing) Predicted to be involved in microtubule-based process; regulation of circadian rhythm; and regulation of heme biosynthetic process. Predicted to be active in cytoplasm and nucleus. [provided by Alliance of Genome Resources, Apr 2022]

HPS4 (HGNC:15844): (HPS4 biogenesis of lysosomal organelles complex 3 subunit 2) This gene encodes a protein component of biogenesis of lysosome-related organelles complexes (BLOC). BLOC complexes are important for the formation of endosomal-lysosomal organelles such as melanosomes and platelet dense granules. Mutations in this gene result in subtype 4 of Hermansky-Pudlak syndrome, a form of albinism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]

HPS4 Gene-Disease associations (from GenCC):

• Hermansky-Pudlak syndrome 4

  Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: G2P, ClinGen, Labcorp Genetics (formerly Invitae), Ambry Genetics
• Hermansky-Pudlak syndrome with pulmonary fibrosis

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001013694.3.
• BP6: Variant 22-26483980-GGAGGCGGCGCCCCGGGGGAGA-G is Benign according to our data. Variant chr22-26483980-GGAGGCGGCGCCCCGGGGGAGA-G is described in CliVar as Benign. Clinvar id is 402950.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr22-26483980-GGAGGCGGCGCCCCGGGGGAGA-G is described in CliVar as Benign. Clinvar id is 402950.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr22-26483980-GGAGGCGGCGCCCCGGGGGAGA-G is described in CliVar as Benign. Clinvar id is 402950.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr22-26483980-GGAGGCGGCGCCCCGGGGGAGA-G is described in CliVar as Benign. Clinvar id is 402950.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr22-26483980-GGAGGCGGCGCCCCGGGGGAGA-G is described in CliVar as Benign. Clinvar id is 402950.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr22-26483980-GGAGGCGGCGCCCCGGGGGAGA-G is described in CliVar as Benign. Clinvar id is 402950.Status of the report is criteria_provided_single_submitter, 1 stars.
• BA1: GnomAd4 highest subpopulation (NFE) allele frequency at 95% confidence interval = 0.895 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SRRD	NM_001013694.3	c.129_149delGAGAGAGGCGGCGCCCCGGGG	p.Arg44_Gly50del	disruptive_inframe_deletion	Exon 1 of 7	ENST00000215917.11	NP_001013716.2
HPS4	NM_022081.6	c.-806_-786delTCTCCCCCGGGGCGCCGCCTC		upstream_gene_variant		ENST00000398145.7	NP_071364.4

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SRRD	ENST00000215917.11	c.129_149delGAGAGAGGCGGCGCCCCGGGG	p.Arg44_Gly50del	disruptive_inframe_deletion	Exon 1 of 7	1	NM_001013694.3	ENSP00000215917.6
HPS4	ENST00000398145.7	c.-806_-786delTCTCCCCCGGGGCGCCGCCTC		upstream_gene_variant		1	NM_022081.6	ENSP00000381213.2

Frequencies

GnomAD3 genomes AF: 0.832 AC: 120670 AN: 145092 Hom.: 51014 Cov.: 0

Gnomad AFR AF: 0.696

Gnomad AMI AF: 0.820

Gnomad AMR AF: 0.768

Gnomad ASJ AF: 0.867

Gnomad EAS AF: 0.869

Gnomad SAS AF: 0.892

Gnomad FIN AF: 0.955

Gnomad MID AF: 0.909

Gnomad NFE AF: 0.901

Gnomad OTH AF: 0.841

GnomAD2 exomes AF: 0.701 AC: 6762 AN: 9648 AF XY: 0.704

Gnomad AFR exome AF: 0.398

Gnomad AMR exome AF: 0.621

Gnomad ASJ exome AF: 0.710

Gnomad EAS exome AF: 0.760

Gnomad FIN exome AF: 0.803

Gnomad NFE exome AF: 0.725

Gnomad OTH exome AF: 0.734

GnomAD4 exome AF: 0.877 AC: 1041942 AN: 1187452 Hom.: 469681 AF XY: 0.878 AC XY: 506057 AN XY: 576574

African (AFR) AF: 0.669 AC: 15501 AN: 23174

American (AMR) AF: 0.728 AC: 7437 AN: 10214

Ashkenazi Jewish (ASJ) AF: 0.836 AC: 13837 AN: 16544

East Asian (EAS) AF: 0.867 AC: 23219 AN: 26778

South Asian (SAS) AF: 0.876 AC: 45359 AN: 51788

European-Finnish (FIN) AF: 0.944 AC: 26658 AN: 28232

Middle Eastern (MID) AF: 0.892 AC: 2979 AN: 3340

European-Non Finnish (NFE) AF: 0.884 AC: 864983 AN: 978956

Other (OTH) AF: 0.867 AC: 41969 AN: 48426

GnomAD4 genome AF: 0.831 AC: 120720 AN: 145198 Hom.: 51022 Cov.: 0 AF XY: 0.832 AC XY: 58656 AN XY: 70508

African (AFR) AF: 0.696 AC: 27614 AN: 39660

American (AMR) AF: 0.767 AC: 11420 AN: 14882

Ashkenazi Jewish (ASJ) AF: 0.867 AC: 2936 AN: 3386

East Asian (EAS) AF: 0.869 AC: 4027 AN: 4636

South Asian (SAS) AF: 0.893 AC: 4002 AN: 4484

European-Finnish (FIN) AF: 0.955 AC: 9095 AN: 9522

Middle Eastern (MID) AF: 0.906 AC: 259 AN: 286

European-Non Finnish (NFE) AF: 0.901 AC: 58983 AN: 65478

Other (OTH) AF: 0.838 AC: 1682 AN: 2008

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.812

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not specified Benign:1

Mar 29, 2016

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant identified in a genome or exome case(s) and assessed due to predicted null impact of the variant or pathogenic assertions in the literature or databases. Disclaimer: This variant has not undergone full assessment. The following are preliminary notes: MAF -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.73
Mutation Taster		=191/9	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs66831137; hg19: chr22-26879946; COSMIC: COSV53226438; COSMIC: COSV53226438;