NM_001083962.2:c.73-825_73-802delGCTGCTGCTGCTGCTGCTGCTGCT

Variant names:

• chr18-55586153-GAGCAGCAGCAGCAGCAGCAGCAGC-G
• rs55725917
• NM_001083962.2:c.73-825_73-802delGCTGCTGCTGCTGCTGCTGCTGCT

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BA1

The NM_001083962.2(TCF4):​c.73-825_73-802delGCTGCTGCTGCTGCTGCTGCTGCT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0145 in 571,664 control chromosomes in the GnomAD database, including 718 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. The gene TCF4 is included in the ClinGen Criteria Specification Registry.

• Frequency:
  • Genomes: 𝑓 0.037 (166 hom., cov: 0)
  • Exomes 𝑓: 0.014 (718 hom.)
  • Failed GnomAD Quality Control
• Consequence: TCF4 NM_001083962.2 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.885
• Publications: 0 publications found

Genes affected

TCF4 (HGNC:11634): (transcription factor 4) This gene encodes transcription factor 4, a basic helix-loop-helix transcription factor. The encoded protein recognizes an Ephrussi-box ('E-box') binding site ('CANNTG') - a motif first identified in immunoglobulin enhancers. This gene is broadly expressed, and may play an important role in nervous system development. Defects in this gene are a cause of Pitt-Hopkins syndrome. In addition, an intronic CTG repeat normally numbering 10-37 repeat units can expand to >50 repeat units and cause Fuchs endothelial corneal dystrophy. Multiple alternatively spliced transcript variants that encode different proteins have been described. [provided by RefSeq, Jul 2016]

TCF4 Gene-Disease associations (from GenCC):

• Pitt-Hopkins syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet, G2P, ClinGen, PanelApp Australia, Labcorp Genetics (formerly Invitae)
• corneal dystrophy, Fuchs endothelial, 3

  Inheritance: AD Classification: STRONG Submitted by: G2P
• autosomal dominant non-syndromic intellectual disability

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Fuchs' endothelial dystrophy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• autism spectrum disorder

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
• intellectual disability

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Specifications for TCF4 are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Benign. The variant received -8 ACMG points.

• BA1: GnomAdExome4 highest subpopulation (AFR) allele frequency at 95% confidence interval = 0.054 is higher than 0.05.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001083962.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TCF4	NM_001083962.2	MANE Select	c.73-825_73-802delGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	NP_001077431.1	P15884-3
	TCF4	NM_001243226.3		c.379-825_379-802delGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	NP_001230155.2	E9PH57
	TCF4	NM_001243228.2		c.73-825_73-802delGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	NP_001230157.1	H3BTP3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TCF4	ENST00000354452.8	TSL:5 MANE Select	c.73-825_73-802delGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	ENSP00000346440.3	P15884-3
	TCF4	ENST00000398339.5	TSL:1	c.379-825_379-802delGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	ENSP00000381382.1	E9PH57
	TCF4	ENST00000356073.8	TSL:1	c.73-825_73-802delGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	ENSP00000348374.4	P15884-1

Frequencies

GnomAD3 genomes AF: 0.0366 AC: 4961 AN: 135388 Hom.: 166 Cov.: 0

Gnomad AFR AF: 0.0852

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0269

Gnomad ASJ AF: 0.0236

Gnomad EAS AF: 0.00706

Gnomad SAS AF: 0.00602

Gnomad FIN AF: 0.00701

Gnomad MID AF: 0.0493

Gnomad NFE AF: 0.0188

Gnomad OTH AF: 0.0291

GnomAD4 exome AF: 0.0145 AC: 8268 AN: 571664 Hom.: 718 AF XY: 0.0140 AC XY: 4194 AN XY: 298682

African (AFR) AF: 0.0569 AC: 1022 AN: 17970

American (AMR) AF: 0.0170 AC: 374 AN: 21988

Ashkenazi Jewish (ASJ) AF: 0.0235 AC: 350 AN: 14884

East Asian (EAS) AF: 0.00636 AC: 153 AN: 24068

South Asian (SAS) AF: 0.00504 AC: 268 AN: 53216

European-Finnish (FIN) AF: 0.0127 AC: 297 AN: 23308

Middle Eastern (MID) AF: 0.0136 AC: 33 AN: 2432

European-Non Finnish (NFE) AF: 0.0133 AC: 5135 AN: 386074

Other (OTH) AF: 0.0229 AC: 636 AN: 27724

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.0366 AC: 4962 AN: 135480 Hom.: 166 Cov.: 0 AF XY: 0.0356 AC XY: 2331 AN XY: 65532

African (AFR) AF: 0.0851 AC: 3201 AN: 37634

American (AMR) AF: 0.0269 AC: 348 AN: 12936

Ashkenazi Jewish (ASJ) AF: 0.0236 AC: 75 AN: 3176

East Asian (EAS) AF: 0.00685 AC: 30 AN: 4382

South Asian (SAS) AF: 0.00602 AC: 24 AN: 3988

European-Finnish (FIN) AF: 0.00701 AC: 64 AN: 9124

Middle Eastern (MID) AF: 0.0496 AC: 14 AN: 282

European-Non Finnish (NFE) AF: 0.0188 AC: 1152 AN: 61246

Other (OTH) AF: 0.0288 AC: 54 AN: 1874

Alfa AF: 0.00 Hom.: 287

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.89
Mutation Taster		=100/0	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs55725917;

hg19: chr18-53253384;