NM_001083962.2:c.73-828_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCT

Variant names:

• chr18-55586153-GAGCAGCAGCAGCAGCAGCAGCAGCAGC-G
• rs55725917
• NM_001083962.2:c.73-828_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCT

Variant summary

Our verdict is Benign. Variant got -8 ACMG points: 0P and 8B. BA1

The NM_001083962.2(TCF4):​c.73-828_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0456 in 570,400 control chromosomes in the GnomAD database, including 2,507 homozygotes. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.091 (683 hom., cov: 0)
  • Exomes 𝑓: 0.046 (2507 hom.)
  • Failed GnomAD Quality Control
• Consequence: TCF4 NM_001083962.2 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.885

Genes affected

TCF4 (HGNC:11634): (transcription factor 4) This gene encodes transcription factor 4, a basic helix-loop-helix transcription factor. The encoded protein recognizes an Ephrussi-box ('E-box') binding site ('CANNTG') - a motif first identified in immunoglobulin enhancers. This gene is broadly expressed, and may play an important role in nervous system development. Defects in this gene are a cause of Pitt-Hopkins syndrome. In addition, an intronic CTG repeat normally numbering 10-37 repeat units can expand to >50 repeat units and cause Fuchs endothelial corneal dystrophy. Multiple alternatively spliced transcript variants that encode different proteins have been described. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Benign. Variant got -8 ACMG points.

• BA1: GnomAdExome4 highest subpopulation (AFR) allele frequency at 95% confidence interval = 0.0807 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TCF4	NM_001083962.2	c.73-828_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCT		intron_variant	Intron 2 of 19	ENST00000354452.8	NP_001077431.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TCF4	ENST00000354452.8	c.73-828_73-802delGCTGCTGCTGCTGCTGCTGCTGCTGCT		intron_variant	Intron 2 of 19	5	NM_001083962.2	ENSP00000346440.3

Frequencies

GnomAD3 genomes AF: 0.0909 AC: 12296 AN: 135326 Hom.: 686 Cov.: 0

Gnomad AFR AF: 0.147

Gnomad AMI AF: 0.168

Gnomad AMR AF: 0.0782

Gnomad ASJ AF: 0.0507

Gnomad EAS AF: 0.0561

Gnomad SAS AF: 0.0288

Gnomad FIN AF: 0.112

Gnomad MID AF: 0.0428

Gnomad NFE AF: 0.0644

Gnomad OTH AF: 0.0804

GnomAD4 exome AF: 0.0456 AC: 26031 AN: 570400 Hom.: 2507 AF XY: 0.0460 AC XY: 13702 AN XY: 298064

Gnomad4 AFR exome AF: 0.0842

Gnomad4 AMR exome AF: 0.0429

Gnomad4 ASJ exome AF: 0.0432

Gnomad4 EAS exome AF: 0.0572

Gnomad4 SAS exome AF: 0.0261

Gnomad4 FIN exome AF: 0.134

Gnomad4 NFE exome AF: 0.0398

Gnomad4 OTH exome AF: 0.0573

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.0909 AC: 12305 AN: 135420 Hom.: 683 Cov.: 0 AF XY: 0.0906 AC XY: 5933 AN XY: 65494

Gnomad4 AFR AF: 0.147

Gnomad4 AMR AF: 0.0780

Gnomad4 ASJ AF: 0.0507

Gnomad4 EAS AF: 0.0557

Gnomad4 SAS AF: 0.0283

Gnomad4 FIN AF: 0.112

Gnomad4 NFE AF: 0.0644

Gnomad4 OTH AF: 0.0795

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs55725917; hg19: chr18-53253384;