NM_001134382.3:c.3140_3163delACCCACCCCAGCACATCCAGCACG

Variant names:

• chr3-12901164-GCGTGCTGGATGTGCTGGGGTGGGT-G
• NM_001134382.3:c.3140_3163delACCCACCCCAGCACATCCAGCACG

Variant summary

Our verdict is Uncertain significance. Variant got 1 ACMG points: 2P and 1B. PM2 BP3

The NM_001134382.3(IQSEC1):​c.3140_3163delACCCACCCCAGCACATCCAGCACG​(p.His1047_Ala1055delinsPro) variant causes a disruptive inframe deletion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: IQSEC1 NM_001134382.3 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 6.95

Genes affected

IQSEC1 (HGNC:29112): (IQ motif and Sec7 domain ArfGEF 1) Predicted to enable protein kinase binding activity. Predicted to be involved in several processes, including positive regulation of focal adhesion disassembly; positive regulation of keratinocyte migration; and regulation of postsynaptic neurotransmitter receptor internalization. Located in nucleolus. Implicated in intellectual developmental disorder with short stature and behavioral abnormalities. [provided by Alliance of Genome Resources, Apr 2022]

LOC105376956 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 1 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• BP3: Nonframeshift variant in repetitive region in NM_001134382.3

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
IQSEC1	NM_001134382.3	c.3140_3163delACCCACCCCAGCACATCCAGCACG	p.His1047_Ala1055delinsPro	disruptive_inframe_deletion	Exon 14 of 14	ENST00000613206.2	NP_001127854.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
IQSEC1	ENST00000613206.2	c.3140_3163delACCCACCCCAGCACATCCAGCACG	p.His1047_Ala1055delinsPro	disruptive_inframe_deletion	Exon 14 of 14	2	NM_001134382.3	ENSP00000480301.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Intellectual developmental disorder with short stature and behavioral abnormalities Uncertain:1

Apr 04, 2024

Genomic Medicine Center of Excellence, King Faisal Specialist Hospital and Research Centre

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr3-12942663;