NM_001165963.4:c.1096_1115delGATACCTTCAGTTGGGCTTT
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_001165963.4(SCN1A):c.1096_1115delGATACCTTCAGTTGGGCTTT(p.Asp366PhefsTer77) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. D366D) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay. The gene SCN1A is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_001165963.4 frameshift
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001165963.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SCN1A | MANE Select | c.1096_1115delGATACCTTCAGTTGGGCTTT | p.Asp366PhefsTer77 | frameshift | Exon 11 of 29 | NP_001159435.1 | P35498-1 | ||
| SCN1A | c.1096_1115delGATACCTTCAGTTGGGCTTT | p.Asp366PhefsTer77 | frameshift | Exon 10 of 28 | NP_001189364.1 | P35498-1 | |||
| SCN1A | c.1096_1115delGATACCTTCAGTTGGGCTTT | p.Asp366PhefsTer77 | frameshift | Exon 9 of 27 | NP_001340877.1 | P35498-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SCN1A | MANE Select | c.1096_1115delGATACCTTCAGTTGGGCTTT | p.Asp366PhefsTer77 | frameshift | Exon 11 of 29 | ENSP00000501589.1 | P35498-1 | ||
| SCN1A | TSL:5 | c.1096_1115delGATACCTTCAGTTGGGCTTT | p.Asp366PhefsTer77 | frameshift | Exon 10 of 28 | ENSP00000303540.4 | P35498-1 | ||
| SCN1A | TSL:5 | c.1096_1115delGATACCTTCAGTTGGGCTTT | p.Asp366PhefsTer77 | frameshift | Exon 8 of 26 | ENSP00000364554.3 | P35498-2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at