chr2-166047681-AAAAGCCCAACTGAAGGTATC-A

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_001165963.4(SCN1A):​c.1096_1115delGATACCTTCAGTTGGGCTTT​(p.Asp366PhefsTer77) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

SCN1A
NM_001165963.4 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 10.0
Variant links:
Genes affected
SCN1A (HGNC:10585): (sodium voltage-gated channel alpha subunit 1) Voltage-dependent sodium channels are heteromeric complexes that regulate sodium exchange between intracellular and extracellular spaces and are essential for the generation and propagation of action potentials in muscle cells and neurons. Each sodium channel is composed of a large pore-forming, glycosylated alpha subunit and two smaller beta subunits. This gene encodes a sodium channel alpha subunit, which has four homologous domains, each of which contains six transmembrane regions. Allelic variants of this gene are associated with generalized epilepsy with febrile seizures and epileptic encephalopathy. Alternative splicing results in multiple transcript variants. The RefSeq Project has decided to create four representative RefSeq records. Three of the transcript variants are supported by experimental evidence and the fourth contains alternate 5' untranslated exons, the exact combination of which have not been experimentally confirmed for the full-length transcript. [provided by RefSeq, Oct 2015]
SCN1A-AS1 (HGNC:54069): (SCN1A and SCN9A antisense RNA 1)

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 2-166047681-AAAAGCCCAACTGAAGGTATC-A is Pathogenic according to our data. Variant chr2-166047681-AAAAGCCCAACTGAAGGTATC-A is described in ClinVar as [Pathogenic]. Clinvar id is 189955.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
SCN1ANM_001165963.4 linkc.1096_1115delGATACCTTCAGTTGGGCTTT p.Asp366PhefsTer77 frameshift_variant Exon 11 of 29 ENST00000674923.1 NP_001159435.1 P35498-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
SCN1AENST00000674923.1 linkc.1096_1115delGATACCTTCAGTTGGGCTTT p.Asp366PhefsTer77 frameshift_variant Exon 11 of 29 NM_001165963.4 ENSP00000501589.1 P35498-1
SCN1AENST00000303395.9 linkc.1096_1115delGATACCTTCAGTTGGGCTTT p.Asp366PhefsTer77 frameshift_variant Exon 10 of 28 5 ENSP00000303540.4 P35498-1
SCN1AENST00000375405.7 linkc.1096_1115delGATACCTTCAGTTGGGCTTT p.Asp366PhefsTer77 frameshift_variant Exon 8 of 26 5 ENSP00000364554.3 P35498-2
SCN1AENST00000409050.1 linkc.1096_1115delGATACCTTCAGTTGGGCTTT p.Asp366PhefsTer77 frameshift_variant Exon 8 of 26 5 ENSP00000386312.1 P35498-3

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Severe myoclonic epilepsy in infancy Pathogenic:1
Dec 20, 2014
Center for Bioinformatics, Peking University
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: research

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs794726792; hg19: chr2-166904191; API