NM_001165963.4:c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_001165963.4(SCN1A):c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT(p.Arg187fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Genomes: not found (cov: 32)
Consequence
SCN1A
NM_001165963.4 frameshift, splice_donor, splice_region, intron
NM_001165963.4 frameshift, splice_donor, splice_region, intron
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 10.0
Genes affected
SCN1A (HGNC:10585): (sodium voltage-gated channel alpha subunit 1) Voltage-dependent sodium channels are heteromeric complexes that regulate sodium exchange between intracellular and extracellular spaces and are essential for the generation and propagation of action potentials in muscle cells and neurons. Each sodium channel is composed of a large pore-forming, glycosylated alpha subunit and two smaller beta subunits. This gene encodes a sodium channel alpha subunit, which has four homologous domains, each of which contains six transmembrane regions. Allelic variants of this gene are associated with generalized epilepsy with febrile seizures and epileptic encephalopathy. Alternative splicing results in multiple transcript variants. The RefSeq Project has decided to create four representative RefSeq records. Three of the transcript variants are supported by experimental evidence and the fourth contains alternate 5' untranslated exons, the exact combination of which have not been experimentally confirmed for the full-length transcript. [provided by RefSeq, Oct 2015]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 12 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 2-166054631-CACTTACGCAAATGTAATGACAGTGAAATCGAGCCAGTTCCATGGATCCCG-C is Pathogenic according to our data. Variant chr2-166054631-CACTTACGCAAATGTAATGACAGTGAAATCGAGCCAGTTCCATGGATCCCG-C is described in ClinVar as [Pathogenic]. Clinvar id is 448259.Status of the report is criteria_provided_single_submitter, 1 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
SCN1A | NM_001165963.4 | c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT | p.Arg187fs | frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant | Exon 7 of 29 | ENST00000674923.1 | NP_001159435.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
SCN1A | ENST00000674923.1 | c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT | p.Arg187fs | frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant | Exon 7 of 29 | NM_001165963.4 | ENSP00000501589.1 | |||
SCN1A | ENST00000303395.9 | c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT | p.Arg187fs | frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant | Exon 6 of 28 | 5 | ENSP00000303540.4 | |||
SCN1A | ENST00000375405.7 | c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT | p.Arg187fs | frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant | Exon 4 of 26 | 5 | ENSP00000364554.3 | |||
SCN1A | ENST00000409050.1 | c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT | p.Arg187fs | frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant | Exon 4 of 26 | 5 | ENSP00000386312.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
not provided Pathogenic:1
Sep 28, 2016
Athena Diagnostics
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing
- -
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at