rs1553551304

Variant names:

• chr2-166054631-CACTTACGCAAATGTAATGACAGTGAAATCGAGCCAGTTCCATGGATCCCG-C
• rs1553551304
• NM_001165963.4:c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_001165963.4(SCN1A):​c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT​(p.Arg187fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: SCN1A NM_001165963.4 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 10.0
• Publications: 0 publications found

Genes affected

SCN1A (HGNC:10585): (sodium voltage-gated channel alpha subunit 1) Voltage-dependent sodium channels are heteromeric complexes that regulate sodium exchange between intracellular and extracellular spaces and are essential for the generation and propagation of action potentials in muscle cells and neurons. Each sodium channel is composed of a large pore-forming, glycosylated alpha subunit and two smaller beta subunits. This gene encodes a sodium channel alpha subunit, which has four homologous domains, each of which contains six transmembrane regions. Allelic variants of this gene are associated with generalized epilepsy with febrile seizures and epileptic encephalopathy. Alternative splicing results in multiple transcript variants. The RefSeq Project has decided to create four representative RefSeq records. Three of the transcript variants are supported by experimental evidence and the fourth contains alternate 5' untranslated exons, the exact combination of which have not been experimentally confirmed for the full-length transcript. [provided by RefSeq, Oct 2015]

SCN1A-AS1 (HGNC:54069): (SCN1A and SCN9A antisense RNA 1)

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 2-166054631-CACTTACGCAAATGTAATGACAGTGAAATCGAGCCAGTTCCATGGATCCCG-C is Pathogenic according to our data. Variant chr2-166054631-CACTTACGCAAATGTAATGACAGTGAAATCGAGCCAGTTCCATGGATCCCG-C is described in ClinVar as Pathogenic. ClinVar VariationId is 448259.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SCN1A	NM_001165963.4	c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT	p.Arg187fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 7 of 29	ENST00000674923.1	NP_001159435.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SCN1A	ENST00000674923.1	c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT	p.Arg187fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 7 of 29		NM_001165963.4	ENSP00000501589.1
SCN1A	ENST00000303395.9	c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT	p.Arg187fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 6 of 28	5		ENSP00000303540.4
SCN1A	ENST00000375405.7	c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT	p.Arg187fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 4 of 26	5		ENSP00000364554.3
SCN1A	ENST00000409050.2	c.559_602+6delCGGGATCCATGGAACTGGCTCGATTTCACTGTCATTACATTTGCGTAAGT	p.Arg187fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 6 of 28	5		ENSP00000386312.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

Sep 28, 2016

Athena Diagnostics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		10
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553551304; hg19: chr2-166911141;