NM_001174147.2:c.58_100dupGACTGCGCCAAGATGTTGGACGGCATCAAGATGGAGGAGCACG

Variant names:

• chr9-126614503-G-GACGGACTGCGCCAAGATGTTGGACGGCATCAAGATGGAGGAGC
• NM_001174147.2:c.58_100dupGACTGCGCCAAGATGTTGGACGGCATCAAGATGGAGGAGCACG

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_001174147.2(LMX1B):​c.58_100dupGACTGCGCCAAGATGTTGGACGGCATCAAGATGGAGGAGCACG​(p.Ala34GlyfsTer128) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 30)
• Consequence: LMX1B NM_001174147.2 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 0.156

Genes affected

LMX1B (HGNC:6654): (LIM homeobox transcription factor 1 beta) This gene encodes a member of LIM-homeodomain family of proteins containing two N-terminal zinc-binding LIM domains, 1 homeodomain, and a C-terminal glutamine-rich domain. It functions as a transcription factor, and is essential for the normal development of dorsal limb structures, the glomerular basement membrane, the anterior segment of the eye, and dopaminergic and serotonergic neurons. Mutations in this gene are associated with nail-patella syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 9-126614503-G-GACGGACTGCGCCAAGATGTTGGACGGCATCAAGATGGAGGAGC is Pathogenic according to our data. Variant chr9-126614503-G-GACGGACTGCGCCAAGATGTTGGACGGCATCAAGATGGAGGAGC is described in ClinVar as [Pathogenic]. Clinvar id is 3602075.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
LMX1B	NM_001174147.2	c.58_100dupGACTGCGCCAAGATGTTGGACGGCATCAAGATGGAGGAGCACG	p.Ala34GlyfsTer128	frameshift_variant	Exon 1 of 8	ENST00000373474.9	NP_001167618.1
LMX1B	NM_001174146.2	c.58_100dupGACTGCGCCAAGATGTTGGACGGCATCAAGATGGAGGAGCACG	p.Ala34GlyfsTer128	frameshift_variant	Exon 1 of 8		NP_001167617.1
LMX1B	NM_002316.4	c.58_100dupGACTGCGCCAAGATGTTGGACGGCATCAAGATGGAGGAGCACG	p.Ala34GlyfsTer128	frameshift_variant	Exon 1 of 8		NP_002307.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
LMX1B	ENST00000373474.9	c.58_100dupGACTGCGCCAAGATGTTGGACGGCATCAAGATGGAGGAGCACG	p.Ala34GlyfsTer128	frameshift_variant	Exon 1 of 8	1	NM_001174147.2	ENSP00000362573.3
LMX1B	ENST00000355497.10	c.58_100dupGACTGCGCCAAGATGTTGGACGGCATCAAGATGGAGGAGCACG	p.Ala34GlyfsTer128	frameshift_variant	Exon 1 of 8	1		ENSP00000347684.5
LMX1B	ENST00000526117.6	c.58_100dupGACTGCGCCAAGATGTTGGACGGCATCAAGATGGAGGAGCACG	p.Ala34GlyfsTer128	frameshift_variant	Exon 1 of 8	1		ENSP00000436930.1

Frequencies

GnomAD3 genomes Cov.: 30

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 30

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Nail-patella syndrome Pathogenic:1

Jan 21, 2025

Gemeinschaftspraxis fuer Humangenetik Dresden

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The variant c.58_100dup, p.(Ala34Glyfs*128) is not reported in HGMD 2024.4, gnomAD (v4.1.1), dbSNP (v156) or LOVD (we submitted there) so far. Due to the protein truncating character the variant is classified as pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr9-129376782;