NM_001205254.2:c.173_194delGGACCTCTCCTCCAGGAGTGAT
Variant summary
Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1PP5
The NM_001205254.2(OCLN):c.173_194delGGACCTCTCCTCCAGGAGTGAT(p.Trp58PhefsTer10) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000657 in 152,184 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_001205254.2 frameshift
Scores
Clinical Significance
Conservation
Publications
- pseudo-TORCH syndrome 1Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- pseudo-TORCH syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 9 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001205254.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| OCLN | MANE Select | c.173_194delGGACCTCTCCTCCAGGAGTGAT | p.Trp58PhefsTer10 | frameshift | Exon 3 of 9 | NP_001192183.1 | Q16625-1 | ||
| OCLN | c.173_194delGGACCTCTCCTCCAGGAGTGAT | p.Trp58PhefsTer10 | frameshift | Exon 3 of 9 | NP_001425533.1 | ||||
| OCLN | c.173_194delGGACCTCTCCTCCAGGAGTGAT | p.Trp58PhefsTer10 | frameshift | Exon 3 of 9 | NP_002529.1 | Q16625-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| OCLN | TSL:1 MANE Select | c.173_194delGGACCTCTCCTCCAGGAGTGAT | p.Trp58PhefsTer10 | frameshift | Exon 3 of 9 | ENSP00000379719.2 | Q16625-1 | ||
| OCLN | TSL:1 | c.173_194delGGACCTCTCCTCCAGGAGTGAT | p.Trp58PhefsTer10 | frameshift | Exon 3 of 9 | ENSP00000347379.2 | Q16625-1 | ||
| OCLN | TSL:1 | c.-24-4685_-24-4664delGGACCTCTCCTCCAGGAGTGAT | intron | N/A | ENSP00000445940.1 | Q16625-4 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152184Hom.: 0 Cov.: 32 show subpopulations
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152184Hom.: 0 Cov.: 32 AF XY: 0.0000135 AC XY: 1AN XY: 74344 show subpopulations
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at