NM_001205254.2:c.173_194delGGACCTCTCCTCCAGGAGTGAT

Variant names:

• chr5-69509260-AATGGACCTCTCCTCCAGGAGTG-A
• rs797045841
• NM_001205254.2:c.173_194delGGACCTCTCCTCCAGGAGTGAT

Variant summary

Our verdict is Pathogenic. Variant got 11 ACMG points: 11P and 0B. PVS1 PM2 PP5

The NM_001205254.2(OCLN):​c.173_194delGGACCTCTCCTCCAGGAGTGAT​(p.Trp58PhefsTer10) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000657 in 152,184 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: 𝑓 0.0000066 (0 hom., cov: 32)
• Consequence: OCLN NM_001205254.2 frameshift
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:3 U:1
• Conservation: PhyloP100: 9.81

Genes affected

OCLN (HGNC:8104): (occludin) This gene encodes an integral membrane protein that is required for cytokine-induced regulation of the tight junction paracellular permeability barrier. Mutations in this gene are thought to be a cause of band-like calcification with simplified gyration and polymicrogyria (BLC-PMG), an autosomal recessive neurologic disorder that is also known as pseudo-TORCH syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene is present 1.5 Mb downstream on the q arm of chromosome 5. [provided by RefSeq, Apr 2011]

ACMG classification

Verdict is Pathogenic. Variant got 11 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 5-69509260-AATGGACCTCTCCTCCAGGAGTG-A is Pathogenic according to our data. Variant chr5-69509260-AATGGACCTCTCCTCCAGGAGTG-A is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 211775.We mark this variant Likely_pathogenic, oryginal submissions are: {Uncertain_significance=1, Pathogenic=3}. Variant chr5-69509260-AATGGACCTCTCCTCCAGGAGTG-A is described in Lovd as [Likely_pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
OCLN	NM_001205254.2	c.173_194delGGACCTCTCCTCCAGGAGTGAT	p.Trp58PhefsTer10	frameshift_variant	Exon 3 of 9	ENST00000396442.7	NP_001192183.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
OCLN	ENST00000396442.7	c.173_194delGGACCTCTCCTCCAGGAGTGAT	p.Trp58PhefsTer10	frameshift_variant	Exon 3 of 9	1	NM_001205254.2	ENSP00000379719.2

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152184 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.000478

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152184 Hom.: 0 Cov.: 32 AF XY: 0.0000135 AC XY: 1 AN XY: 74344

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.000478

Bravo AF: 0.00000378

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Pathogenic:3 Uncertain:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

Pseudo-TORCH syndrome 1 Pathogenic:2 Uncertain:1

Jul 23, 2015

Genetic Services Laboratory, University of Chicago

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Jan 01, 2019

Genomic Research Center, Shahid Beheshti University of Medical Sciences

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Dec 03, 2018

Broad Center for Mendelian Genomics, Broad Institute of MIT and Harvard

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: research

The homozygous p.Trp58PhefsTer10 variant in OCLN was identified by our study in one individual with pseudo-torch syndrome. This variant was absent from large population studies. The homozygous variant was also reported in two Turkish siblings with pseudo-torch syndrome (PMID: 20727516). This variant is predicted to cause a frameshift, which alters the protein's amino acid sequence beginning at position 58 and leads to a premature termination codon 10 amino acids downstream. This alteration is then predicted to lead to a truncated or absent protein. At least two loss of function variants across multiple exons have been reported in association with pseudo-torch syndrome in ClinVar. Loss of function of the OCLN gene is a moderately established disease mechanism in autosomal recessive pseudo-torch syndrome. O'Driscoll et al. reported that five out of the six families with pseudo-torch syndrome in their study had variants that impacted the conserved MARVEL protein domain, which is associated with localization to the cellular membrane (PMID: 20727516). This suggests that variants in the MARVEL domain may not be tolerated. In summary, while there is some suspicion for a pathogenic role, the clinical significance of this variant is uncertain. ACMG/AMP Criteria applied: PM2, PVS1_Moderate, PM1_Supporting (Richards 2015). -

not provided Pathogenic:1

Oct 23, 2020

Institute of Medical Genetics and Applied Genomics, University Hospital Tübingen

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs797045841; hg19: chr5-68805087;