chr5-69509260-AATGGACCTCTCCTCCAGGAGTG-A

Variant names:

• chr5-69509260-AATGGACCTCTCCTCCAGGAGTG-A
• rs797045841
• NM_001205254.2:c.173_194delGGACCTCTCCTCCAGGAGTGAT

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_002538.4(OCLN):​c.173_194delGGACCTCTCCTCCAGGAGTGAT​(p.Trp58PhefsTer10) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000657 in 152,184 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: 𝑓 0.0000066 (0 hom., cov: 32)
• Consequence: OCLN NM_002538.4 frameshift
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:4 U:1
• Conservation: PhyloP100: 9.81
• Publications: 2 publications found

Genes affected

OCLN (HGNC:8104): (occludin) This gene encodes an integral membrane protein that is required for cytokine-induced regulation of the tight junction paracellular permeability barrier. Mutations in this gene are thought to be a cause of band-like calcification with simplified gyration and polymicrogyria (BLC-PMG), an autosomal recessive neurologic disorder that is also known as pseudo-TORCH syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene is present 1.5 Mb downstream on the q arm of chromosome 5. [provided by RefSeq, Apr 2011]

OCLN Gene-Disease associations (from GenCC):

• pseudo-TORCH syndrome 1

  Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: PanelApp Australia, G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
• pseudo-TORCH syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 5-69509260-AATGGACCTCTCCTCCAGGAGTG-A is Pathogenic according to our data. Variant chr5-69509260-AATGGACCTCTCCTCCAGGAGTG-A is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 211775.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_002538.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	OCLN	NM_001205254.2	MANE Select	c.173_194delGGACCTCTCCTCCAGGAGTGAT	p.Trp58PhefsTer10	frameshift	Exon 3 of 9	NP_001192183.1
	OCLN	NM_001438604.1		c.173_194delGGACCTCTCCTCCAGGAGTGAT	p.Trp58PhefsTer10	frameshift	Exon 3 of 9	NP_001425533.1
	OCLN	NM_002538.4		c.173_194delGGACCTCTCCTCCAGGAGTGAT	p.Trp58PhefsTer10	frameshift	Exon 3 of 9	NP_002529.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	OCLN	ENST00000396442.7	TSL:1 MANE Select	c.173_194delGGACCTCTCCTCCAGGAGTGAT	p.Trp58PhefsTer10	frameshift	Exon 3 of 9	ENSP00000379719.2
	OCLN	ENST00000355237.6	TSL:1	c.173_194delGGACCTCTCCTCCAGGAGTGAT	p.Trp58PhefsTer10	frameshift	Exon 3 of 9	ENSP00000347379.2
	OCLN	ENST00000538151.2	TSL:1	c.-24-4685_-24-4664delGGACCTCTCCTCCAGGAGTGAT		intron	N/A	ENSP00000445940.1

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152184 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.000478

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152184 Hom.: 0 Cov.: 32 AF XY: 0.0000135 AC XY: 1 AN XY: 74344

African (AFR) AF: 0.00 AC: 0 AN: 41442

American (AMR) AF: 0.00 AC: 0 AN: 15266

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5204

South Asian (SAS) AF: 0.00 AC: 0 AN: 4828

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10616

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 68038

Other (OTH) AF: 0.000478 AC: 1 AN: 2092

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

ClinVar submissions as Germline

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
3	1	-	Pseudo-TORCH syndrome 1 (4)
1	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.8
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs797045841; hg19: chr5-68805087;