chr5-69509260-AATGGACCTCTCCTCCAGGAGTG-A
Variant summary
Our verdict is Pathogenic. The variant received 11 ACMG points: 11P and 0B. PVS1PM2PP5
The NM_001205254.2(OCLN):c.173_194delGGACCTCTCCTCCAGGAGTGAT(p.Trp58PhefsTer10) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000657 in 152,184 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_001205254.2 frameshift
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 11 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152184Hom.: 0 Cov.: 32 show subpopulations
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152184Hom.: 0 Cov.: 32 AF XY: 0.0000135 AC XY: 1AN XY: 74344 show subpopulations
ClinVar
Submissions by phenotype
Pseudo-TORCH syndrome 1 Pathogenic:2Uncertain:1
- -
- -
The homozygous p.Trp58PhefsTer10 variant in OCLN was identified by our study in one individual with pseudo-torch syndrome. This variant was absent from large population studies. The homozygous variant was also reported in two Turkish siblings with pseudo-torch syndrome (PMID: 20727516). This variant is predicted to cause a frameshift, which alters the protein's amino acid sequence beginning at position 58 and leads to a premature termination codon 10 amino acids downstream. This alteration is then predicted to lead to a truncated or absent protein. At least two loss of function variants across multiple exons have been reported in association with pseudo-torch syndrome in ClinVar. Loss of function of the OCLN gene is a moderately established disease mechanism in autosomal recessive pseudo-torch syndrome. O'Driscoll et al. reported that five out of the six families with pseudo-torch syndrome in their study had variants that impacted the conserved MARVEL protein domain, which is associated with localization to the cellular membrane (PMID: 20727516). This suggests that variants in the MARVEL domain may not be tolerated. In summary, while there is some suspicion for a pathogenic role, the clinical significance of this variant is uncertain. ACMG/AMP Criteria applied: PM2, PVS1_Moderate, PM1_Supporting (Richards 2015). -
not provided Pathogenic:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at