NM_001385641.1:c.610-23_610-3dupTTCCTCTCCTCCTGCCCCACC

Variant names:

• chr1-930081-A-AGCCCCACCTTCCTCTCCTCCT
• rs879326979
• NM_001385641.1:c.610-23_610-3dupTTCCTCTCCTCCTGCCCCACC

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BS1 BS2

The NM_001385641.1(SAMD11):​c.610-23_610-3dupTTCCTCTCCTCCTGCCCCACC variant causes a splice acceptor, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000445 in 1,475,002 control chromosomes in the GnomAD database, including 16 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00020 (0 hom., cov: 33)
  • Exomes 𝑓: 0.00047 (16 hom.)
• Consequence: SAMD11 NM_001385641.1 splice_acceptor, intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.291
• Publications: 0 publications found

Genes affected

SAMD11 (HGNC:28706): (sterile alpha motif domain containing 11) Predicted to enable several functions, including histone binding activity; protein domain specific binding activity; and protein self-association. Predicted to be involved in negative regulation of transcription, DNA-templated. Predicted to act upstream of or within negative regulation of transcription by RNA polymerase II. Predicted to be active in nucleus. [provided by Alliance of Genome Resources, Apr 2022]

SAMD11 Gene-Disease associations (from GenCC):

• retinitis pigmentosa

  Inheritance: AR Classification: STRONG, LIMITED Submitted by: Ambry Genetics, G2P, Franklin by Genoox

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• BS1: Variant frequency is greater than expected in population eas. GnomAdExome4 allele frequency = 0.000473 (626/1323458) while in subpopulation EAS AF = 0.0169 (589/34838). AF 95% confidence interval is 0.0158. There are 16 homozygotes in GnomAdExome4. There are 320 alleles in the male GnomAdExome4 subpopulation. This position passed quality control check.
• BS2: High Homozygotes in GnomAdExome4 at 16 AR gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001385641.1. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SAMD11	NM_001385641.1	MANE Select	c.610-23_610-3dupTTCCTCTCCTCCTGCCCCACC		splice_acceptor intron	N/A	NP_001372570.1	A0A087WU74
	SAMD11	NM_001385640.1		c.610-23_610-3dupTTCCTCTCCTCCTGCCCCACC		splice_acceptor intron	N/A	NP_001372569.1	A0A087WX24
	SAMD11	NM_152486.4		c.73-23_73-3dupTTCCTCTCCTCCTGCCCCACC		splice_acceptor intron	N/A	NP_689699.3	Q96NU1-3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SAMD11	ENST00000616016.5	TSL:5 MANE Select	c.610-74_610-73insGCCCCACCTTCCTCTCCTCCT		intron	N/A	ENSP00000478421.2	A0A087WU74
	SAMD11	ENST00000968543.1		c.610-74_610-73insGCCCCACCTTCCTCTCCTCCT		intron	N/A	ENSP00000638602.1
	SAMD11	ENST00000618323.5	TSL:5	c.610-74_610-73insGCCCCACCTTCCTCTCCTCCT		intron	N/A	ENSP00000480678.2	A0A087WX24

Frequencies

GnomAD3 genomes AF: 0.000198 AC: 30 AN: 151426 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.000194

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000657

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00330

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000590

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.000473 AC: 626 AN: 1323458 Hom.: 16 AF XY: 0.000494 AC XY: 320 AN XY: 647992

African (AFR) AF: 0.0000331 AC: 1 AN: 30198

American (AMR) AF: 0.0000618 AC: 2 AN: 32362

Ashkenazi Jewish (ASJ) AF: 0.0000462 AC: 1 AN: 21666

East Asian (EAS) AF: 0.0169 AC: 589 AN: 34838

South Asian (SAS) AF: 0.000144 AC: 10 AN: 69430

European-Finnish (FIN) AF: 0.0000218 AC: 1 AN: 45972

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3876

European-Non Finnish (NFE) AF: 0.0000146 AC: 15 AN: 1030186

Other (OTH) AF: 0.000127 AC: 7 AN: 54930

GnomAD4 genome AF: 0.000198 AC: 30 AN: 151544 Hom.: 0 Cov.: 33 AF XY: 0.000162 AC XY: 12 AN XY: 74028

African (AFR) AF: 0.000194 AC: 8 AN: 41274

American (AMR) AF: 0.0000656 AC: 1 AN: 15236

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3462

East Asian (EAS) AF: 0.00331 AC: 17 AN: 5132

South Asian (SAS) AF: 0.00 AC: 0 AN: 4766

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10564

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.0000590 AC: 4 AN: 67806

Other (OTH) AF: 0.00 AC: 0 AN: 2100

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.29
Mutation Taster		=100/0	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs879326979; hg19: chr1-865461;