chr1-930081-A-AGCCCCACCTTCCTCTCCTCCT
Variant summary
Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BS1BS2
The NM_001385641.1(SAMD11):c.610-23_610-3dupTTCCTCTCCTCCTGCCCCACC variant causes a splice acceptor, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000445 in 1,475,002 control chromosomes in the GnomAD database, including 16 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_001385641.1 splice_acceptor, intron
Scores
Clinical Significance
Conservation
Publications
- retinitis pigmentosaInheritance: AR Classification: STRONG, LIMITED Submitted by: Ambry Genetics, G2P, Franklin by Genoox
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001385641.1. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SAMD11 | NM_001385641.1 | MANE Select | c.610-23_610-3dupTTCCTCTCCTCCTGCCCCACC | splice_acceptor intron | N/A | NP_001372570.1 | A0A087WU74 | ||
| SAMD11 | NM_001385640.1 | c.610-23_610-3dupTTCCTCTCCTCCTGCCCCACC | splice_acceptor intron | N/A | NP_001372569.1 | A0A087WX24 | |||
| SAMD11 | NM_152486.4 | c.73-23_73-3dupTTCCTCTCCTCCTGCCCCACC | splice_acceptor intron | N/A | NP_689699.3 | Q96NU1-3 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SAMD11 | ENST00000616016.5 | TSL:5 MANE Select | c.610-74_610-73insGCCCCACCTTCCTCTCCTCCT | intron | N/A | ENSP00000478421.2 | A0A087WU74 | ||
| SAMD11 | ENST00000968543.1 | c.610-74_610-73insGCCCCACCTTCCTCTCCTCCT | intron | N/A | ENSP00000638602.1 | ||||
| SAMD11 | ENST00000618323.5 | TSL:5 | c.610-74_610-73insGCCCCACCTTCCTCTCCTCCT | intron | N/A | ENSP00000480678.2 | A0A087WX24 |
Frequencies
GnomAD3 genomes AF: 0.000198 AC: 30AN: 151426Hom.: 0 Cov.: 33 show subpopulations
GnomAD4 exome AF: 0.000473 AC: 626AN: 1323458Hom.: 16 AF XY: 0.000494 AC XY: 320AN XY: 647992 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000198 AC: 30AN: 151544Hom.: 0 Cov.: 33 AF XY: 0.000162 AC XY: 12AN XY: 74028 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at