chr1-930081-A-AGCCCCACCTTCCTCTCCTCCT

Variant names:

• chr1-930081-A-AGCCCCACCTTCCTCTCCTCCT
• rs879326979
• NM_001385641.1:c.610-23_610-3dupTTCCTCTCCTCCTGCCCCACC

Variant summary

Our verdict is Benign. Variant got -8 ACMG points: 0P and 8B. BS1 BS2

The NM_001385641.1(SAMD11):​c.610-23_610-3dupTTCCTCTCCTCCTGCCCCACC variant causes a splice acceptor, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000445 in 1,475,002 control chromosomes in the GnomAD database, including 16 homozygotes. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00020 (0 hom., cov: 33)
  • Exomes 𝑓: 0.00047 (16 hom.)
• Consequence: SAMD11 NM_001385641.1 splice_acceptor, intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.291

Genes affected

SAMD11 (HGNC:28706): (sterile alpha motif domain containing 11) Predicted to enable several functions, including histone binding activity; protein domain specific binding activity; and protein self-association. Predicted to be involved in negative regulation of transcription, DNA-templated. Predicted to act upstream of or within negative regulation of transcription by RNA polymerase II. Predicted to be active in nucleus. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Verdict is Benign. Variant got -8 ACMG points.

• BS1: Variant frequency is greater than expected in population eas. gnomad4_exome allele frequency = 0.000473 (626/1323458) while in subpopulation EAS AF= 0.0169 (589/34838). AF 95% confidence interval is 0.0158. There are 16 homozygotes in gnomad4_exome. There are 320 alleles in male gnomad4_exome subpopulation. This position pass quality control queck.
• BS2: High Homozygotes in GnomAdExome4 at 16 AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SAMD11	NM_001385641.1	c.610-23_610-3dupTTCCTCTCCTCCTGCCCCACC		splice_acceptor_variant, intron_variant	Intron 2 of 13	ENST00000616016.5	NP_001372570.1
SAMD11	NM_001385640.1	c.610-23_610-3dupTTCCTCTCCTCCTGCCCCACC		splice_acceptor_variant, intron_variant	Intron 2 of 13		NP_001372569.1
SAMD11	NM_152486.4	c.73-23_73-3dupTTCCTCTCCTCCTGCCCCACC		splice_acceptor_variant, intron_variant	Intron 2 of 13		NP_689699.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SAMD11	ENST00000616016.5	c.610-74_610-73insGCCCCACCTTCCTCTCCTCCT		intron_variant	Intron 2 of 13	5	NM_001385641.1	ENSP00000478421.2

Frequencies

GnomAD3 genomes AF: 0.000198 AC: 30 AN: 151426 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.000194

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000657

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00330

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000590

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.000473 AC: 626 AN: 1323458 Hom.: 16 AF XY: 0.000494 AC XY: 320 AN XY: 647992

Gnomad4 AFR exome AF: 0.0000331

Gnomad4 AMR exome AF: 0.0000618

Gnomad4 ASJ exome AF: 0.0000462

Gnomad4 EAS exome AF: 0.0169

Gnomad4 SAS exome AF: 0.000144

Gnomad4 FIN exome AF: 0.0000218

Gnomad4 NFE exome AF: 0.0000146

Gnomad4 OTH exome AF: 0.000127

GnomAD4 genome AF: 0.000198 AC: 30 AN: 151544 Hom.: 0 Cov.: 33 AF XY: 0.000162 AC XY: 12 AN XY: 74028

Gnomad4 AFR AF: 0.000194

Gnomad4 AMR AF: 0.0000656

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00331

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000590

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs879326979; hg19: chr1-865461;