NM_001399.5:c.546_581delTGGACCCAATGGCCCTCCAGGACCCCCAGGACCTCC

Variant names:

• chrX-70027865-GCAGGACCTCCTGGACCCAATGGCCCTCCAGGACCCC-G
• rs397516665
• NM_001399.5:c.546_581delTGGACCCAATGGCCCTCCAGGACCCCCAGGACCTCC

Variant summary

Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PM1 PM4 PP5_Very_Strong

The NM_001399.5(EDA):​c.546_581delTGGACCCAATGGCCCTCCAGGACCCCCAGGACCTCC​(p.Gly183_Pro194del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.00000134 in 745,840 control chromosomes in the GnomAD database, with no homozygous occurrence. There are no hemizygote samples in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. P182P) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 21)
  • Exomes 𝑓: 0.0000013 (0 hom. 0 hem.)
• Consequence: EDA NM_001399.5 disruptive_inframe_deletion
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:4
• Conservation: PhyloP100: 7.10
• Publications: 4 publications found

Genes affected

EDA (HGNC:3157): (ectodysplasin A) The protein encoded by this gene is a type II membrane protein that can be cleaved by furin to produce a secreted form. The encoded protein, which belongs to the tumor necrosis factor family, acts as a homotrimer and may be involved in cell-cell signaling during the development of ectodermal organs. Defects in this gene are a cause of ectodermal dysplasia, anhidrotic, which is also known as X-linked hypohidrotic ectodermal dysplasia. Several transcript variants encoding many different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

EDA Gene-Disease associations (from GenCC):

• tooth agenesis, selective, X-linked, 1

  Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
• X-linked hypohidrotic ectodermal dysplasia

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Labcorp Genetics (formerly Invitae), Orphanet
• tooth agenesis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 12 ACMG points.

• PM1: In a hotspot region, there are 2 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 3 uncertain in NM_001399.5
• PM4: Nonframeshift variant in NON repetitive region in NM_001399.5.
• PP5: Variant X-70027865-GCAGGACCTCCTGGACCCAATGGCCCTCCAGGACCCC-G is Pathogenic according to our data. Variant chrX-70027865-GCAGGACCTCCTGGACCCAATGGCCCTCCAGGACCCC-G is described in ClinVar as Pathogenic. ClinVar VariationId is 44197.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001399.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EDA	NM_001399.5	MANE Select	c.546_581delTGGACCCAATGGCCCTCCAGGACCCCCAGGACCTCC	p.Gly183_Pro194del	disruptive_inframe_deletion	Exon 4 of 8	NP_001390.1	Q92838-1
	EDA	NM_001005609.2		c.546_581delTGGACCCAATGGCCCTCCAGGACCCCCAGGACCTCC	p.Gly183_Pro194del	disruptive_inframe_deletion	Exon 4 of 8	NP_001005609.1	Q92838-3
	EDA	NM_001440761.1		c.546_581delTGGACCCAATGGCCCTCCAGGACCCCCAGGACCTCC	p.Gly183_Pro194del	disruptive_inframe_deletion	Exon 4 of 8	NP_001427690.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EDA	ENST00000374552.9	TSL:1 MANE Select	c.546_581delTGGACCCAATGGCCCTCCAGGACCCCCAGGACCTCC	p.Gly183_Pro194del	disruptive_inframe_deletion	Exon 4 of 8	ENSP00000363680.4	Q92838-1
	EDA	ENST00000374553.6	TSL:1	c.546_581delTGGACCCAATGGCCCTCCAGGACCCCCAGGACCTCC	p.Gly183_Pro194del	disruptive_inframe_deletion	Exon 4 of 8	ENSP00000363681.2	Q92838-3
	EDA	ENST00000524573.5	TSL:1	c.546_581delTGGACCCAATGGCCCTCCAGGACCCCCAGGACCTCC	p.Gly183_Pro194del	disruptive_inframe_deletion	Exon 4 of 8	ENSP00000432585.1	Q92838-9

Frequencies

GnomAD3 genomes Cov.: 21

GnomAD4 exome AF: 0.00000134 AC: 1 AN: 745840 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 207216

African (AFR) AF: 0.00 AC: 0 AN: 18785

American (AMR) AF: 0.00 AC: 0 AN: 28215

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 16716

East Asian (EAS) AF: 0.00 AC: 0 AN: 25994

South Asian (SAS) AF: 0.00 AC: 0 AN: 43778

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 37781

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3435

European-Non Finnish (NFE) AF: 0.00000186 AC: 1 AN: 536882

Other (OTH) AF: 0.00 AC: 0 AN: 34254

GnomAD4 genome Cov.: 21

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
3	-	-	Hypohidrotic X-linked ectodermal dysplasia (3)
1	-	-	Hypohidrotic X-linked ectodermal dysplasia;C1970757:Tooth agenesis, selective, X-linked, 1 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.1
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs397516665; hg19: chrX-69247715;