rs397516665

Variant names:

• chrX-70027865-GCAGGACCTCCTGGACCCAATGGCCCTCCAGGACCCC-G
• rs397516665
• NM_001399.5:c.546_581delTGGACCCAATGGCCCTCCAGGACCCCCAGGACCTCC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PM2 PM4 PP5_Very_Strong

The NM_001399.5(EDA):​c.546_581delTGGACCCAATGGCCCTCCAGGACCCCCAGGACCTCC​(p.Gly183_Pro194del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.00000134 in 745,840 control chromosomes in the GnomAD database, with no homozygous occurrence. There are no hemizygote samples in GnomAD. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency:
  • Genomes: not found (cov: 21)
  • Exomes 𝑓: 0.0000013 (0 hom. 0 hem.)
• Consequence: EDA NM_001399.5 disruptive_inframe_deletion
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:4
• Conservation: PhyloP100: 7.10

Genes affected

EDA (HGNC:3157): (ectodysplasin A) The protein encoded by this gene is a type II membrane protein that can be cleaved by furin to produce a secreted form. The encoded protein, which belongs to the tumor necrosis factor family, acts as a homotrimer and may be involved in cell-cell signaling during the development of ectodermal organs. Defects in this gene are a cause of ectodermal dysplasia, anhidrotic, which is also known as X-linked hypohidrotic ectodermal dysplasia. Several transcript variants encoding many different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_001399.5.
• PP5: Variant X-70027865-GCAGGACCTCCTGGACCCAATGGCCCTCCAGGACCCC-G is Pathogenic according to our data. Variant chrX-70027865-GCAGGACCTCCTGGACCCAATGGCCCTCCAGGACCCC-G is described in ClinVar as [Pathogenic]. Clinvar id is 44197.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chrX-70027865-GCAGGACCTCCTGGACCCAATGGCCCTCCAGGACCCC-G is described in Lovd as [Pathogenic]. Variant chrX-70027865-GCAGGACCTCCTGGACCCAATGGCCCTCCAGGACCCC-G is described in Lovd as [Pathogenic]. Variant chrX-70027865-GCAGGACCTCCTGGACCCAATGGCCCTCCAGGACCCC-G is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
EDA	NM_001399.5	c.546_581delTGGACCCAATGGCCCTCCAGGACCCCCAGGACCTCC	p.Gly183_Pro194del	disruptive_inframe_deletion	Exon 4 of 8	ENST00000374552.9	NP_001390.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
EDA	ENST00000374552.9	c.546_581delTGGACCCAATGGCCCTCCAGGACCCCCAGGACCTCC	p.Gly183_Pro194del	disruptive_inframe_deletion	Exon 4 of 8	1	NM_001399.5	ENSP00000363680.4

Frequencies

GnomAD3 genomes Cov.: 21

GnomAD4 exome AF: 0.00000134 AC: 1 AN: 745840 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 207216

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000186

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 21

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Hypohidrotic X-linked ectodermal dysplasia Pathogenic:3

Feb 19, 2024

Institute of Human Genetics, University of Leipzig Medical Center

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Criteria applied: PS2,PS4,PM4,PM2_SUP,PP4 -

Jan 30, 2018

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The p.Asn185_Pro196del (c.546_581del and c.553_588del) in-frame deletion in EDA has been identified in >10 individuals with X-linked hypohidrotic ectodermal dys plasia (de novo in at least 2 of these individuals) and segregated with disease in 1 affected relative (Bayes 1998, Monreal 1998, Schneider 2001, Lexner 2008, v an der Hout 2008, Schneider 2011, LMM data). Two different deletions (c.546_581d el and c.553_588del), which result in the same p.Asn185_Pro196del in-frame delet ion, have been reported in the individuals described above. In summary, this var iant meets criteria to be classified as pathogenic for X-linked hypohidrotic ect odermal dysplasia based upon its identification in affected individuals and de n ovo occurrences. ACMG/AMP Criteria applied: PS4; PM6_Strong; PM4; PP4. -

Aug 27, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. Experimental studies have shown that this variant does not substantially affect EDA function (PMID: 11279189). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. ClinVar contains an entry for this variant (Variation ID: 44197). This variant has been observed in individual(s) with ectodermal dysplasia (PMID: 9683615, 23553579, 31796081, 31924237). In at least one individual the variant was observed to be de novo. This variant is not present in population databases (gnomAD no frequency). This variant, c.546_581del, results in the deletion of 12 amino acid(s) of the EDA protein (p.Asn185_Pro196del), but otherwise preserves the integrity of the reading frame. -

Hypohidrotic X-linked ectodermal dysplasia;C1970757:Tooth agenesis, selective, X-linked, 1 Pathogenic:1

Feb 20, 2022

Fulgent Genetics, Fulgent Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs397516665; hg19: chrX-69247715;