NM_001458.5:c.2390-10_2406delTTCTCTGCAGGCGACGTGAGCATCGGC
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_001458.5(FLNC):c.2390-10_2406delTTCTCTGCAGGCGACGTGAGCATCGGC(p.Gly797fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000685 in 1,460,640 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. G797G) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_001458.5 frameshift, splice_acceptor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- dilated cardiomyopathyInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen, Ambry Genetics, G2P
- myofibrillar myopathy 5Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, ClinGen, G2P
- hypertrophic cardiomyopathy 26Inheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, PanelApp Australia
- distal myopathy with posterior leg and anterior hand involvementInheritance: AD Classification: MODERATE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics
- familial isolated restrictive cardiomyopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- heart conduction diseaseInheritance: AD Classification: LIMITED Submitted by: Genomics England PanelApp
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| FLNC | NM_001458.5 | c.2390-10_2406delTTCTCTGCAGGCGACGTGAGCATCGGC | p.Gly797fs | frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant | Exon 16 of 48 | ENST00000325888.13 | NP_001449.3 | |
| FLNC | NM_001127487.2 | c.2390-10_2406delTTCTCTGCAGGCGACGTGAGCATCGGC | p.Gly797fs | frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant | Exon 16 of 47 | NP_001120959.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| FLNC | ENST00000325888.13 | c.2390-12_2404delGCTTCTCTGCAGGCGACGTGAGCATCG | p.Asp798_Gly802del | splice_acceptor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant | Exon 16 of 48 | 1 | NM_001458.5 | ENSP00000327145.8 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome AF: 6.85e-7 AC: 1AN: 1460640Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 726594 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
not provided Pathogenic:1
Deletion of 27 nucleotide bases that spans the canonical splice acceptor site of intron 15 and is predicted to result in a null allele in a gene for which loss of function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); Has not been previously published as pathogenic or benign to our knowledge
Myofibrillar myopathy 5;C3279722:Distal myopathy with posterior leg and anterior hand involvement;C4310749:Hypertrophic cardiomyopathy 26;CN239310:Dilated Cardiomyopathy, Dominant Pathogenic:1
This variant results in the deletion of part of exon 16 (c.2390-10_2406del) of the FLNC gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in FLNC are known to be pathogenic (PMID: 27908349). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with FLNC-related conditions. ClinVar contains an entry for this variant (Variation ID: 478125). For these reasons, this variant has been classified as Pathogenic.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at