rs1554398674

Variant names:

• chr7-128842781-CGCTTCTCTGCAGGCGACGTGAGCATCG-C
• rs1554398674
• NM_001458.5:c.2390-10_2406delTTCTCTGCAGGCGACGTGAGCATCGGC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1_Moderate PM2 PP5_Very_Strong

The ENST00000325888.13(FLNC):​c.2390-12_2404delGCTTCTCTGCAGGCGACGTGAGCATCG​(p.Asp798_Gly802del) variant causes a splice acceptor, conservative inframe deletion, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000685 in 1,460,640 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. G797G) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
• Consequence: FLNC ENST00000325888.13 splice_acceptor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 0.613

Genes affected

FLNC (HGNC:3756): (filamin C) This gene encodes one of three related filamin genes, specifically gamma filamin. These filamin proteins crosslink actin filaments into orthogonal networks in cortical cytoplasm and participate in the anchoring of membrane proteins for the actin cytoskeleton. Three functional domains exist in filamin: an N-terminal filamentous actin-binding domain, a C-terminal self-association domain, and a membrane glycoprotein-binding domain. Mutations in this gene are a cause of cardiopathy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2022]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.019686965 fraction of the gene. Cryptic splice site detected, with MaxEntScore 3, offset of 24, new splice context is: aggcgtggtgggccctgcAGagg. Cryptic site results in inframe change. If cryptic site found is not functional and variant results in exon loss, it results in frameshift change.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 7-128842781-CGCTTCTCTGCAGGCGACGTGAGCATCG-C is Pathogenic according to our data. Variant chr7-128842781-CGCTTCTCTGCAGGCGACGTGAGCATCG-C is described in ClinVar as [Pathogenic]. Clinvar id is 478125.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
FLNC	NM_001458.5	c.2390-10_2406delTTCTCTGCAGGCGACGTGAGCATCGGC	p.Gly797fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 16 of 48	ENST00000325888.13	NP_001449.3
FLNC	NM_001127487.2	c.2390-10_2406delTTCTCTGCAGGCGACGTGAGCATCGGC	p.Gly797fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 16 of 47		NP_001120959.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
FLNC	ENST00000325888.13	c.2390-12_2404delGCTTCTCTGCAGGCGACGTGAGCATCG	p.Asp798_Gly802del	splice_acceptor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	Exon 16 of 48	1	NM_001458.5	ENSP00000327145.8
FLNC	ENST00000346177.6	c.2390-12_2404delGCTTCTCTGCAGGCGACGTGAGCATCG	p.Asp798_Gly802del	splice_acceptor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	Exon 16 of 47	1		ENSP00000344002.6
FLNC	ENST00000388853.3	n.506-12_520delGCTTCTCTGCAGGCGACGTGAGCATCG		splice_acceptor_variant, splice_region_variant, intron_variant, non_coding_transcript_exon_variant	Exon 4 of 4	2

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 6.85e-7 AC: 1 AN: 1460640 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 726594

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 8.99e-7

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Pathogenic:1

Mar 24, 2025

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Deletion of 27 nucleotide bases that spans the canonical splice acceptor site of intron 15 and is predicted to result in a null allele in a gene for which loss of function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); Has not been previously published as pathogenic or benign to our knowledge -

Myofibrillar myopathy 5;C3279722:Distal myopathy with posterior leg and anterior hand involvement;C4310749:Hypertrophic cardiomyopathy 26;CN239310:Dilated Cardiomyopathy, Dominant Pathogenic:1

Dec 11, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant results in the deletion of part of exon 16 (c.2390-10_2406del) of the FLNC gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in FLNC are known to be pathogenic (PMID: 27908349). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with FLNC-related conditions. ClinVar contains an entry for this variant (Variation ID: 478125). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554398674; hg19: chr7-128482835;