rs1554398674

Variant names:

• chr7-128842781-CGCTTCTCTGCAGGCGACGTGAGCATCG-C
• rs1554398674
• NM_001458.5:c.2390-10_2406delTTCTCTGCAGGCGACGTGAGCATCGGC

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_001458.5(FLNC):​c.2390-10_2406delTTCTCTGCAGGCGACGTGAGCATCGGC​(p.Gly797fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000685 in 1,460,640 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. G797G) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
• Consequence: FLNC NM_001458.5 frameshift, splice_acceptor, splice_region, intron
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 0.613
• Publications: 0 publications found

Genes affected

FLNC (HGNC:3756): (filamin C) This gene encodes one of three related filamin genes, specifically gamma filamin. These filamin proteins crosslink actin filaments into orthogonal networks in cortical cytoplasm and participate in the anchoring of membrane proteins for the actin cytoskeleton. Three functional domains exist in filamin: an N-terminal filamentous actin-binding domain, a C-terminal self-association domain, and a membrane glycoprotein-binding domain. Mutations in this gene are a cause of cardiopathy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2022]

FLNC Gene-Disease associations (from GenCC):

• dilated cardiomyopathy

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen, Ambry Genetics, G2P
• myofibrillar myopathy 5

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, ClinGen, G2P
• hypertrophic cardiomyopathy 26

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, PanelApp Australia
• distal myopathy with posterior leg and anterior hand involvement

  Inheritance: AD Classification: MODERATE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics
• familial isolated restrictive cardiomyopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• heart conduction disease

  Inheritance: AD Classification: LIMITED Submitted by: Genomics England PanelApp

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 7-128842781-CGCTTCTCTGCAGGCGACGTGAGCATCG-C is Pathogenic according to our data. Variant chr7-128842781-CGCTTCTCTGCAGGCGACGTGAGCATCG-C is described in ClinVar as Pathogenic. ClinVar VariationId is 478125.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
FLNC	NM_001458.5	c.2390-10_2406delTTCTCTGCAGGCGACGTGAGCATCGGC	p.Gly797fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 16 of 48	ENST00000325888.13	NP_001449.3
FLNC	NM_001127487.2	c.2390-10_2406delTTCTCTGCAGGCGACGTGAGCATCGGC	p.Gly797fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 16 of 47		NP_001120959.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
FLNC	ENST00000325888.13	c.2390-12_2404delGCTTCTCTGCAGGCGACGTGAGCATCG	p.Asp798_Gly802del	splice_acceptor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	Exon 16 of 48	1	NM_001458.5	ENSP00000327145.8

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 6.85e-7 AC: 1 AN: 1460640 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 726594

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33470

American (AMR) AF: 0.00 AC: 0 AN: 44674

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26118

East Asian (EAS) AF: 0.00 AC: 0 AN: 39680

South Asian (SAS) AF: 0.00 AC: 0 AN: 86190

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52614

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 8.99e-7 AC: 1 AN: 1111782

Other (OTH) AF: 0.00 AC: 0 AN: 60344

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Pathogenic:1

Mar 24, 2025

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Deletion of 27 nucleotide bases that spans the canonical splice acceptor site of intron 15 and is predicted to result in a null allele in a gene for which loss of function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); Has not been previously published as pathogenic or benign to our knowledge -

Myofibrillar myopathy 5;C3279722:Distal myopathy with posterior leg and anterior hand involvement;C4310749:Hypertrophic cardiomyopathy 26;CN239310:Dilated Cardiomyopathy, Dominant Pathogenic:1

Dec 11, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant results in the deletion of part of exon 16 (c.2390-10_2406del) of the FLNC gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in FLNC are known to be pathogenic (PMID: 27908349). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with FLNC-related conditions. ClinVar contains an entry for this variant (Variation ID: 478125). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.61
Mutation Taster		=2/198	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554398674; hg19: chr7-128482835;