rs1554398674

Positions:

• chr7-128842781-CGCTTCTCTGCAGGCGACGTGAGCATCG-C

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_001458.5(FLNC):​c.2390-10_2406delTTCTCTGCAGGCGACGTGAGCATCGGC​(p.Gly797fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000685 in 1,460,640 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
• Consequence: FLNC NM_001458.5 frameshift, splice_acceptor, splice_region, intron
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 0.613

Genes affected

FLNC (HGNC:3756): (filamin C) This gene encodes one of three related filamin genes, specifically gamma filamin. These filamin proteins crosslink actin filaments into orthogonal networks in cortical cytoplasm and participate in the anchoring of membrane proteins for the actin cytoskeleton. Three functional domains exist in filamin: an N-terminal filamentous actin-binding domain, a C-terminal self-association domain, and a membrane glycoprotein-binding domain. Mutations in this gene are a cause of cardiopathy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2022]

FLNC (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 7-128842781-CGCTTCTCTGCAGGCGACGTGAGCATCG-C is Pathogenic according to our data. Variant chr7-128842781-CGCTTCTCTGCAGGCGACGTGAGCATCG-C is described in ClinVar as [Pathogenic]. Clinvar id is 478125.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
FLNC	NM_001458.5	c.2390-10_2406delTTCTCTGCAGGCGACGTGAGCATCGGC	p.Gly797fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	16/48	ENST00000325888.13	NP_001449.3
FLNC	NM_001127487.2	c.2390-10_2406delTTCTCTGCAGGCGACGTGAGCATCGGC	p.Gly797fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	16/47		NP_001120959.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
FLNC	ENST00000325888.13	c.2390-10_2406delTTCTCTGCAGGCGACGTGAGCATCGGC	p.Gly797fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	16/48	1	NM_001458.5	ENSP00000327145.8
FLNC	ENST00000346177.6	c.2390-10_2406delTTCTCTGCAGGCGACGTGAGCATCGGC	p.Gly797fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	16/47	1		ENSP00000344002.6
FLNC	ENST00000388853.3	n.506-10_522delTTCTCTGCAGGCGACGTGAGCATCGGC		splice_acceptor_variant, splice_region_variant, intron_variant, non_coding_transcript_exon_variant	4/4	2

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 6.85e-7 AC: 1 AN: 1460640 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 726594

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 8.99e-7

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

GeneDx

Sep 10, 2024

Deletion of 27 nucleotide bases that spans the canonical splice acceptor site of intron 15 and is predicted to result in a null allele in a gene for which loss of function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); Has not been previously published as pathogenic or benign to our knowledge -

Myofibrillar myopathy 5;C3279722:Distal myopathy with posterior leg and anterior hand involvement;C4310749:Hypertrophic cardiomyopathy 26;CN239310:Dilated Cardiomyopathy, Dominant Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Dec 04, 2023

This variant results in the deletion of part of exon 16 (c.2390-10_2406del) of the FLNC gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in FLNC are known to be pathogenic (PMID: 27908349). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with FLNC-related conditions. ClinVar contains an entry for this variant (Variation ID: 478125). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554398674; hg19: chr7-128482835;